MEGAResFrom MEG, the Microbial Ecology Group

VANXYN

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanN operon and is a core resistance gene.

References

Other Groups in VanN-type resistance protein

Sequences

Download Sequences

>CARD|phgb|JF802084|1592-2165|ARO:3002969|vanXYN|Glycopeptides|VanN-type_resistance_protein|VANXYN
ATGCATAATTTTTATTTACAGCTTGTAAACCAACAACACCCTTGGAAATCATTTAATCATTCGCCACAGCTTGTTCAAGC
GACCTATGCGGAAGAAAAGATTTTAATAGATTCCAAGGTTAACCATCAATTCAATCAGTTACTTGAAACACTACAATTAA
CTGATCGCATCATGATCGTTGATGGTCATCGAACGGTTGCTGAGCAAAAACATTTGTGGAACTATTCTTTAAACGCACAT
GGGGTGAATTATACAAAAAGTTATGTAGCATCTCCTGGCTGTAGTGAACATCATACGGGACTAGCAATTGATCTCGGTCT
ACGAAAGACAGAACATGATCTCATTGCGCCACGCTTCGAGGGACCAGAAGCCGAACTGTTTTTACAACATATGAAAGATT
ATGGATTTATTTTACGCTATCCTAAAAATAAGCAAAAAATTACAGGAATTGCTTATGAGCCTTGGCATTTTCGCTATGTA
GGTACCCCTCATAGTCAAATCATCATGGACCACGGATGGACCTTAGAAGAGTATATTGAATTTTTAAAACATCAAATTGA
GGCGGTCTCATGAA