MEGAResFrom MEG, the Microbial Ecology Group

VANTN

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanN operon and is a core resistance gene.

References

Other Groups in VanN-type resistance protein

Sequences

Download Sequences

>Gly|VanT-N_1_JF802084|Glycopeptides|VanN-type_resistance_protein|VANTN
ATGAAAAACGTAAATACCGGGATCAATCAATTTCGATTGATCGCTGCTTTCATGGTCGTTGCGATTCACTGTTTTCCTTT
TCAGTCGTTTAGTAAAACTCTTGATATATTGATTACTTTGACACTCTTTCGAACTGCCGTACCTTTTTTCTTAATGGTCA
CAGGTTTTTATTTAATTGGACCGATTGCCACTAAGAGAGGCTATCCAGCCTATTTAAAGATAAAAAAATTTTTAAAAAAG
CAAGTGAAGCTATATGTGCTTGCTACGCTCATTTATCTTCCACTAGCTTTTTATAGTGGTGTGATCACTTTCAAGACGAG
TGTCATTCAATTTTTTCAACTCATCTTTTTCGAAGGAGTTCTTTACCACTTGTGGTATTTTCCAGCATTGATTTTAGGTG
TTCTCATCGTTTACTGCTTATTACAGCGGTTCACGCTTCGACAAGTTTTATTAGTGACTTTTCTATTCTATTTACTATGT
TTGGGCGGCGATAGCTGGTGGGGGTTAGCTAGACAAATTCCTGTGTTAGAAAAAAGTTATCAAGGGATATTTACGCTCAT
GATCCATACTCGAAATGGACTATTTTTTGCCCCTTTCTTTTTAACACTCGGTGCTTCGTTCCATCAATCAGAGTGGAACA
TGCGTACATCTAAAGCCAAGTATTTTTTGTTGATTGCTAGTTTAGGCATGCTAGTGGAAAGCTATTTGCTACACTCCTTT
AGTTCACCAAAACATGATAGTGCATACCTATTCTTGCCTGTGGTGATGTTTTTTCTTTTTCCACTTATTTTGAACTGGCA
GCCTACACGTGTCATTGCCGACGCTTCGACAATCAGTTTAGGTATTTATGTCCTTCATCCTTATGTCATTGCTGTTGTCC
ATACTTTAGCCAAAAAAATAACGATACTAAACAATAGTTTAATTTATTATCTCTGCGTTTCCCTTTTAACTAGTTTGATT
ATTCTTTATGTACACTCTAAGAAAAAGAAAACGACAAAAAATCAGGCTACGTTTGTCCCTAGAACAAAAAAAGTACTCTC
TAAGCAAGCAGTTATCCATAATTTGGCACAAATCAATCAAGTGATTCCGAAAACAACGAAAATAATGGCTGTCATAAAAG
CCAACGCTTATGGAACTGATGATACAGAATTTGCTCGAATCTTAGAACAACAAGGAGTTGATTTTTTTGCTGTCGCTACC
ATTGATGAAGGCATTCGTTTGCGAGAAAATGGAATTAAAAGCAAAATCTTAATTCTAGGCTATACACCATCGATACGAAT
AAAAGAATTAGCTCACTACACATTAATACAAACAATCGTTAGCAAAGAACATGCTTATTCATTAAATCAACAAAAGATAC
CTATTTCGTGCCATCTAAAAATTGATACTGGCATGCATCGTTTAGGTGTTGAGCCTGTGGTTCAGGAGGTTTCATCCTTA
TATCGATTACCCTACTTAAATATTCAAGGTATTTATTCTCATCTCGGTTCAGCTGATGATCGAAGTGACAAAGGAATGAA
ACGCACGAGAAAACAAATTTCGATTTTTGATTATTTATTACATGAACTAGAACTTCAAAAAATCGATGTCGGTGTTACGC
ATCTGCAAAGTAGCTATGGTATTTTGAATTATCCTGAACTGGTCTATGATTATGTTCGTCCTGGTATTCTTTTATACGGT
TATTTAAGTGAACATAATGGAGATTCAAAAATCAACTTAAATTTGCAACCAATTTTAGATGTCCAAGCACTGCTCGTATC
AAAAAAATGGGTTGCTGCTGGTGAATATCTTGGCTATAGCCTTGATACTAAACTAGTTTCTCCAAAGCTGATTGGTATCG
TCAGCATCGGCTATGCAGACGGTGTTCCTAGAGAGTTATCTCACAATGAGTTTTTATCTTGCTTATCAGGGACAAAATCT
ACCACAAATCGGACGAATTTGTATGGATATGCTATTAGTGGATTTGACTGA

>Gly|JF802084.2|gene3|Glycopeptides|VanN-type_resistance_protein|VANTN
ATGAAAAACGTAAATACCGGGATCAATCAATTTCGATTGATCGCTGCTTTCATGGTCGTTGCGATTCACTGTTTTCCTTT
TCAGTCGTTTAGTAAAACTCTTGATATATTGATTACTTTGACACTCTTTCGAACTGCCGTACCTTTTTTCTTAATGGTCA
CAGGTTTTTATTTAATTGGACCGATTGCCACTAAGAGAGGCTATCCAGCCTATTTAAAGATAAAAAAATTTTTAAAAAAG
CAAGTGAAGCTATATGTGCTTGCTACGCTCATTTATCTTCCACTAGCTTTTTATAGTGGTGTGATCACTTTCAAGACGAG
TGTCATTCAATTTTTTCAACTCATCTTTTTCGAAGGAGTTCTTTACCACTTGTGGTATTTTCCAGCATTGATTTTAGGTG
TTCTCATCGTTTACTGCTTATTACAGCGGTTCACGCTTCGACAAGTTTTATTAGTGACTTTTCTATTCTATTTACTATGT
TTGGGCGGCGATAGCTGGTGGGGGTTAGCTAGACAAATTCCTGTGTTAGAAAAAAGTTATCAAGGGATATTTACGCTCAT
GATCCATACTCGAAATGGACTATTTTTTGCCCCTTTCTTTTTAACACTCGGTGCTTCGTTCCATCAATCAGAGTGGAACA
TGCGTACATCTAAAGCCAAGTATTTTTTGTTGATTGCTAGTTTAGGCATGCTAGTGGAAAGCTATTTGCTACACTCCTTT
AGTTCACCAAAACATGATAGTGCATACCTATTCTTGCCTGTGGTGATGTTTTTTCTTTTTCCACTTATTTTGAACTGGCA
GCCTACACGTGTCATTGCCGACGCTTCGACAATCAGTTTAGGTATTTATGTCCTTCATCCTTATGTCATTGCTGTTGTCC
ATACTTTAGCCAAAAAAATAACGATACTAAACAATAGTTTAATTTATTATCTCTGCGTTTCCCTTTTAACTAGTTTGATT
ATTCTTTATGTACACTCTAAGAAAAAGAAAACGACAAAAAATCAGGCTACGTTTGTCCCTAGAACAAAAAAAGTACTCTC
TAAGCAAGCAGTTATCCATAATTTGGCACAAATCAATCAAGTGATTCCGAAAACAACGAAAATAATGGCTGTCATAAAAG
CCAACGCTTATGGAACTGATGATACAGAATTTGCTCGAATCTTAGAACAACAAGGAGTTGATTTTTTTGCTGTCGCTACC
ATTGATGAAGGCATTCGTTTGCGAGAAAATGGAATTAAAAGCAAAATCTTAATTCTAGGCTATACACCATCGATACGAAT
AAAAGAATTAGCTCACTACACATTAATACAAACAATCGTTAGCAAAGAACATGCTTATTCATTAAATCAACAAAAGATAC
CTATTTCGTGCCATCTAAAAATTGATACTGGCATGCATCGTTTAGGTGTTGAGCCTGTGGTTCAGGAGGTTTCATCCTTA
TATCGATTACCCTACTTAAATATTCAAGGTATTTATTCTCATCTCGGTTCAGCTGATGATCGAAGTGACAAAGGAATGAA
ACGCACGAGAAAACAAATTTCGATTTTTGATTATTTATTACATGAACTAGAACTTCAAAAAATCGATGTCGGTGTTACGC
ATCTGCAAAGTAGCTATGGTATTTTGAATTATCCTGAACTGGTCTATGATTATGTTCGTCCTGGTATTCTTTTATACGGT
TATTTAAGTGAACATAATGGAGATTCAAAAATCAACTTAAATTTGCAACCAATTTTAGATGTCCAAGCACTGCTCGTATC
AAAAAAATGGGTTGCTGCTGGTGAATATCTTGGCTATAGCCTTGATACTAAACTAGTTTCTCCAAAGCTGATTGGTATCG
TCAGCATCGGCTATGCAGACGGTGTTCCTAGAGAGTTATCTCACAATGAGTTTTATCTTGCTTATCAGGGACAAAATCTA
CCACAAATCGGACGAATTTGTATGGATATGCTATTAGTGGATTTGACTGATTCTCCAGAAATCAAAGTAGAGTCACAAAT
TAGTATCTTCCCAGAACTAGAACAAACTGCTAATCAAACGAATACATTGACTAACGAAATCATCAGTCGCTTAGGTAATC
GTTTCTACACCGAATGGTCCTAA