MEGAResFrom MEG, the Microbial Ecology Group

VANN

The vanN gene encodes a D-ala-D-ser ligase. This gene is part of the VanN operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanN-type resistance protein

Sequences

Download Sequences

>>MEG_7446|Drugs|Glycopeptides|VanN-type_resistance_protein|VANN
ATGAAAAAAATCGCCTTAATTTTTGGTGGTACTTCAGCAGAATATGAAGTATCCCTCAAATCAGCAGCTAGTGTTTTGTC
TGTATTAGAAAATCTAAATGTTGAAATTTACAGAATTGGCATAGCTTCGAACGGAAAATGGTATTTAACCTTTAGTGATA
ATGAAACTATTGCAAATGACTTATGGTTACAAGATAAAAAATTAAATGAGATCACTCCCTCCTTCGATGGGAGAGGGTTT
TATGACCAAGCAGAAAAAGTATATTTTAAACCAGATGTCTTATTTCCGATGCTACACGGTGGCACTGGAGAAAATGGTAC
ATTACAAGGAGTTTTTGAATGTATGCAAATTCCTTATGTTGGTTGCGGCGTTGCCTCCTCTGCCATTTGTATGAATAAAT
ATCTATTACATCAGTTTGCAAAAAGTGTCGGAGTGATGAGTACGCCTACACAGCTGATCTCATCGACGGACGAACAACAA
GTAATCAAAAATTTTACTGAGTTGTACGGTTTTCCTATATTTATCAAACCAAATGAAGCTGGTTCTTCAAAGGGAATCAG
CAAAGTTCATACCGAAGCAGAGTTAACTAAAGCGCTGACCGAAGCGTTCCAATTCAGTCAGACAGTCATTTTACAAAAAG
CTGTTTCTGGAGTAGAGATCGGTTGCGCCATCCTAGGAAATGATCAATTGCTTGTTGGGGAATGTGATGAAGTATCCTTA
GCGACCGACTTTTTTGATTATACGGAAAAATATCAAATGACTACAGCAAAGTTGACCGTTCCAGCAAAAATTCCAGTGGC
AACTAGTAGAGAAATCAAGCGTCAAGCACAATTACTGTATCAATTACTTGGATGTCAGGGCTTAGCTCGCATTGATTTTT
TTCTAACAGAAGCAGGTGAAATTCTCTTAAATGAAATCAATACAATGCCAGGCTTTACCAATCATTCTAGATTTCCAGCC
ATGATGGCAGCTACGGGTATCACTTATCAGGAGCTTATTTCAACATTAATTACTTTAGCGGAGGATAAATAG

>>MEG_7447|Drugs|Glycopeptides|VanN-type_resistance_protein|VANN
ATGAAAAAAATCGCCTTAATTTTTGGTGGTACTTCAGCAGAATATGAAGTATCCCTCAAATCAGCAGCTAGTGTTTTGTC
TGTATTAGAAAATCTAAATGTTGAAATTTACAGAATTGGCATAGCTTCGAACGGAAAATGGTATTTAACCTTTAGTGATA
ATGAAACTATTGCAAATGACTTATGGTTACAAGATAAAAAATTAAATGAGATCACTCCCTCCTTCGATGGGAGAGGGTTT
TATGACCAAGCAGAAAAAGTATATTTTAAACCAGATGTCTTATTTCCGATGCTACACGGTGGCACTGGAGAAAATGGTAC
ATTACAAGGAGTTTTTGAATGTATGCAAATTCCTTATGTTGGTTGCGGCGTTGCCTCCTCTGCCATTTGTATGAATAAAT
ATCTATTACATCAGTTTGCAAAAAGTGTCGGAGTGATGAGTACGCCTACACAGCTGATCTCATCGACGGACGAACAACAA
GTAATCAAAAATTTTACTGAGTTGTACGGTTTTCCTATATTTATCAAACCAAATGAAGCTGGTTCTTCAAAGGGAATCAG
CAAAGTTCATACCGAAGCAGAGTTAACTAAAGCGCTGACCGAAGCGTTCCAATTCAGTCAGACAGTCATTTTACAAAAAG
CTGTTTCTGGAGTAGAGATCGGTTGCGCCATCCTAGGAAATGATCAATTGCTTGTTGGGGAATGTGATGAAGTATCCTTA
GCGACCGACTTTTTTGATTATACGGAAAAATATCAAATGACTACAGCAAAGTTGACCGTTCCAGCAAAAATTCCAGTGGC
AACTAGTAGAGAAATCAAGCGTCAAGCACAATTACTGTATCAATTACTTGGATGTCAGGGCTTAGCTCGCATTGATTTTT
TTCTAACAGAAGCAGGTGAAATTCTCTTAAATGAAATCAATACAATGCCAGGCTTTACCAATCATTCTAGATTTCCAGCC
ATGATGGCAGCTACGGGTATCACTTATCAGGAGCTTATTTCAACATTAATTACTTTAGCGGAGGATAAATAGCATGCATA
ATTTTTATTTACAGCTTGTAAACCAACAACACCCTTGGAAATCATTTAATCATTCGCCACAGCTTGTTCAAGCGACCTAT
GCGGAAGAAAAGATTTTAATAGATTCCAAGGTTAACCATCAATTCAATCAGTTACTTGAAACACTACAATTAACTGATCG
CATCATGATCGTTGATGGTCATCGAACGGTTGCTGAGCAAAAACATTTGTGGAACTATTCTTTAAACGCACATGGGGTGA
ATTATACAAAAAGTTATGTAGCATCTCCTGGCTGTAGTGAACATCATACGGGACTAGCAATTGATCTCGGTCTACGAAAG
ACAGAACATGATCTCATTGCGCCACGCTTCGAGGGACCAGAAGCCGAACTGTTTTTACAACATATGAAAGATTATGGATT
TATTTTACGCTATCCTAAAAATAAGCAAAAAATTACAGGAATTGCTTATGAGCCTTGGCATTTTCGCTATGTAGGTACCC
CTCATAGTCAAATCATCATGGACCACGGATGGACCTTAGAAGAGTATATTGAATTTTTAAAACATCAAATTGAGGCGGTC
TCATGA

>>MEG_7448|Drugs|Glycopeptides|VanN-type_resistance_protein|VANN
ATGGAAATAGGATTTACTTTTTTAGATAAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTT
CACCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCCGAAGCGCTTTTGAAGGCAA
AGGAACTGGCTGCTACCCAAGGTTACGGATTGCTTCTATGGGACGGTTACCGTCCGAAGCGTGCTGTAAATTGTTTTATG
AAATGGGCT