MEGAResFrom MEG, the Microbial Ecology Group

VANN

The vanN gene encodes a D-ala-D-ser ligase. This gene is part of the VanN operon and is a core resistance gene.

References

Other Groups in VanN-type resistance protein

Sequences

Download Sequences

>CARD|phgb|JF802084|559-1591|ARO:3002912|vanN|Glycopeptides|VanN-type_resistance_protein|VANN
ATGAAAAAAATCGCCTTAATTTTTGGTGGTACTTCAGCAGAATATGAAGTATCCCTCAAATCAGCAGCTAGTGTTTTGTC
TGTATTAGAAAATCTAAATGTTGAAATTTACAGAATTGGCATAGCTTCGAACGGAAAATGGTATTTAACCTTTAGTGATA
ATGAAACTATTGCAAATGACTTATGGTTACAAGATAAAAAATTAAATGAGATCACTCCCTCCTTCGATGGGAGAGGGTTT
TATGACCAAGCAGAAAAAGTATATTTTAAACCAGATGTCTTATTTCCGATGCTACACGGTGGCACTGGAGAAAATGGTAC
ATTACAAGGAGTTTTTGAATGTATGCAAATTCCTTATGTTGGTTGCGGCGTTGCCTCCTCTGCCATTTGTATGAATAAAT
ATCTATTACATCAGTTTGCAAAAAGTGTCGGAGTGATGAGTACGCCTACACAGCTGATCTCATCGACGGACGAACAACAA
GTAATCAAAAATTTTACTGAGTTGTACGGTTTTCCTATATTTATCAAACCAAATGAAGCTGGTTCTTCAAAGGGAATCAG
CAAAGTTCATACCGAAGCAGAGTTAACTAAAGCGCTGACCGAAGCGTTCCAATTCAGTCAGACAGTCATTTTACAAAAAG
CTGTTTCTGGAGTAGAGATCGGTTGCGCCATCCTAGGAAATGATCAATTGCTTGTTGGGGAATGTGATGAAGTATCCTTA
GCGACCGACTTTTTTGATTATACGGAAAAATATCAAATGACTACAGCAAAGTTGACCGTTCCAGCAAAAATTCCAGTGGC
AACTAGTAGAGAAATCAAGCGTCAAGCACAATTACTGTATCAATTACTTGGATGTCAGGGCTTAGCTCGCATTGATTTTT
TTCTAACAGAAGCAGGTGAAATTCTCTTAAATGAAATCAATACAATGCCAGGCTTTACCAATCATTCTAGATTTCCAGCC
ATGATGGCAGCTACGGGTATCACTTATCAGGAGCTTATTTCAACATTAATTACTTTAGCGGAGGATAAATAGC