MEGAResFrom MEG, the Microbial Ecology Group

VANSN

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanN operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanN-type regulator

Sequences

Download Sequences

>>MEG_7521|Drugs|Glycopeptides|VanN-type_regulator|VANSN
TTGAAAAATAAGTTGAACGATCCTTTGATCAAAAGAATCTTACTAAGATATGTATCAACCGTTCTTCTTGCGATTGGCAT
TTATGGTGGAGTTTTATTGCTCCTTTTGTTTTTATTCCGTTTACGAACCTGGTATGGCGATGAACCCTTTTATTTATTTT
TACGAACTTTGTATATCCGCTTCAATTTGATTGGCCTCGTCTCAAGTGGTGCGTTTCTTCTTTTGCTGATGATTACTCTC
GTTTATATTTTCAAACTTATTGGCTACTTGAATGAAACTATTACGGCAACTAAACAATTATTGGAAGCACCTGAACAACG
TATCCAACTATCGACCGAGCTATTCACAGTTCAAGAAGAAATGAATCAAATTAGAGAAAATAATAATCAAGCAAACCGTG
CAGCGAAAGTAGCAGAACAACGAAAAAATGATCTGATTGTTTACTTAGCACATGATCTGCGTACATCATTAACTAGCGTG
ATCGGTTATTTGACGTTGTTAAAAGAAGAACCGCAGATCTCCACAGAATTACGAGCAAAATATACGGATATCGCCTTAGA
CAAAGCGTTACGTTTAGAAGAATTGATTGGTGAGTTTTTTGAAGTCACCCAATTCAATTTGACAAAGCTTACAATAAATA
AAGAAATTGTGGATCTAAGTATTATGCTAGAGCAAATCAGCTATGAATTTTTACCAATTCTAAATGAAAAAGGACTTAAA
TGGCAATTAGCGATTGATAAAGGGATCAAAGCAGAAGTTGATCCAAACAAAATGGGACGAGTTTTTGACAATTTAATCCG
TAATGCAATCAATTACAGTTTCTCAAACTCAACGATCCACCTAAGTCTAGAAAAAAATGGACAAAATTTAGAACTCAAAA
TCACAAACGAAACGCATACCTTACCAGAAGAAAAGCTTACGCAAATTTTCGAACCTTTTTATCGTGTCGATACTTCAAGG
AGTAGCAGCACTGGTGGTACAGGACTTGGATTATCGATTGTAAAAGATATCGTGGAAGCATCCGGCGGAAGGATTCATGC
TCAAAGTAGCAATAATCAAATGACATTTACGCTTACCTTGCCTATCAGTGAATAA