MEGAResFrom MEG, the Microbial Ecology Group

VANRN

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanN operon and is a regulator gene.

References

Other Groups in VanN-type regulator

Sequences

Download Sequences

>CARD|phgb|JF802084|4337-5030|ARO:3002929|vanRN|Glycopeptides|VanN-type_regulator|VANRN
ATGGATACAATTGTAATCGTTGATGATGAGAAAGAAATTGCCAATTTAATGACGACCTTTCTAGAAAATGAAGGATTCAA
GGTCATGACCTTTTATAGCGGAAAGGAAGCACTGGATTATATTGATCAAAACGGTGCTTCCTTGGCCATTTTGGATGTGA
TGTTACCTGATTTAGATGGCTTCCAAATATTACAACACATCCGTCAAACATTCTTTTTCCCCGTATTGATGTTGACCGCA
AAAGGAGAAAACTTAGATAAAATCACCGGACTGACTCTAGGCGCAGATGACTACATTACGAAACCTTTCAACCCGCTGGA
AGTCGTGGCGCGAGTAAAAACACAACTGCGACGTACTCAGCGTTACGATCAGCCTTCCCATAGTCAATCGGATGAAGAAT
TTACAAAGGAAGGTTTGGTACTGAAAAAAAACAGCCACCAAGTTTTCTTATTTGATCAAGAAGTGTTGATTACACCCTTG
GAGTTTAAGATCCTGCTCTACCTATTTGAGCATCAAGGGACAGTAGTCTCTTCTGAAACATTATTTGAAGAAGTTTGGCA
AGAAAAATATTTAGACAATAATAATACAGTAATGGCACATATTGCTCGTTTAAGAGAAAAATTAGGCGAAAAACCAAGAA
AACCAAAATATATTAAAACAGTTTGGGGGGTAGGCTATATCATTGAAAAATAAG