MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXM

The vanX gene encodes a dipeptidase. This gene is part of the VanM operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_7571|Drugs|Glycopeptides|VanM-type_resistance_protein|VANXM
ATGAAAAGTGATTTTGTCTTTGTGGACGAGTTGGTATCAGGAATACGTTGGGATGCTAAATACGCCACCTGGGATAATTT
TACCGGCAAACCGGTGGACGGCTATGCAGCCAATCGAATTGTCGGTACGAGAGCGTTGTGCGCGGCCTTGGAAAAAGCAC
GGGAAAACGCCGCATCCTTGGGCTTTGGCTTGCTTCTTTGGGATGGTTACCGCCCTCAATGCGCCGTAGATTGCTTTCTG
CGCTGGTCTAAACAGCCGGAAGATGGCCGGACGAAACAGAAACACTATCCGAATATTGACCGATCCGAGATCATCGAAAA
AGGATATGTGGCTGCCAAGTCGGGCCACAGCCGGGGCAGCGCCATTGATTTAACCCTTTATCATTTAGCTTCCGGAACAC
TTGTGCCCATGGGCGGTGATTTTGATTTGATGGATTCAGTCTCACATCATGGCGCACATGGAATCAGCCAAGCCGAAGCG
AGAAACCGTCAATATCTTTGTTCGATCATGGAGGCCAGCGGTTTTGTTTCCTACGCTTGCGAGTGGTGGCATTACAGCCT
GAAACACGAACCTTATCCCAACACTTACTTTGATTTTCTCATCGCCTAGCTGAGCCGGAGCTCAGCGTGCGGCGGCATCT
GGGAATGCCGGCGGAAGTGAGCATAAGACCTGGCGGAATACATACAGTGTAAAACATGCTGTTCCGCTAGTGCAAAACCG
GAAATAGCAATCTTGACGACGAGAGCTGTGAGGTGCTTTTTGCAATGGAAATGACAGTACGCGAAATCGTTGCCGCCTGC
GGCGGAAAATTACTCTGCGGGGACCCGGATACGATGGTGACCTCGGTGGTGACCGACAGCCGGAAAGTGACCGACGGTTC
CCTGTTTGTCCCCCTCAAAGGCGAAAAGGCGGACGCCCACACCTTTCTGCACGCCGCATTCGCCTCGGGTGCAGCCGCGG
CACTGACCCAGGAGCATATGCGGATGGAGGCGGAAGAAGCCTGGATCGCGGTGGATTCGACTCAGCTGGCGCTCCAGCAG
ATTGCCGCCGCCTATCGGCAGAGATTTTCCATCCCTGTCGTCGGGATCACAGGGAGCGCCGGGAAGACGACGACGAAAGA
AATGACCGCACTGGCACTTTCCGCAGGATACAAGGTGATGAAGACGGGAGGAAACCATAACAGCCAGATCGGACTGCCCC
TGATGATGTTTCAGTTTTCCTGGGAACACGAAGCGGCGGTGGTGGAGATGGGGATAAGCGATTTCGGCGAAATGGCGCGC
CTGGCTCAGGTCGCCGAGCCGAAGTACGCCGTCATGACCAACCTCGGCATTACTCACATCGGCCAGCTCAAAACCCAGGG
GAACATCCTGCGGGAGAAGCTGCACATCACCGACCGGTTCACTCAGGGTTCCGTTCTGTTTTTAAACGGGGACGATCCGA
TGCTGGCCGGACTCCGCGGCAAGACAGGGTATGAGACCGTTTTTTATGGCAGGTTGCCTTGGTGTGATTTTCGCGCGGAG
GGGATTACGGTTCAAGAGGAAACCACCGCTTTCCGCTGCCTTGCTCCGGGGAGCGAGAGCGTGGAGGTGACCCTGCCGGT
ACTGGGAATGCACCATGTTCTGGATGCCCTGGCCGCTCTGGCCGTGGCGGAGCGGCTGGGCGTGCCTCTGAAACGGGCCG
CCGCCGCACTCAGGGATTACCGCCCCCTGGCCATGCGCCAGCAGATTTACCATGTCAATGAGGTTGCCGTCATTGATGAT
TCCTACAACTCCAGTCCCGGCGCGGCCAAAAGCAGCCTGAGTGTTCTTGCGGGGTTCCGGGCCGGCCGCAGAGTAGCCGT
GCTGGCGGATATGCTGGAACTGGGGGAGTATTCCCGGCAGGCGCATTTTGAAGTCGGCGTCTGCGCTGCGGAAAACGGAG
TGGATATTTTACTCACCGTCGGTCAGGAGGCGAAAGCCGTGGCCGAGGGTGCCCGCTCCGTCCGGGCCGGGATCGACTGC
CGCGTTTTGGACAATAACTATCAGGCCGCTGAGGAGTTGAAATCCTTTCTGTCTCCCGGTGACGCAGTTCTGGTCAAAGG
CTCCCGCGGCATGCATACGGAGGAGATCGTCCGCGCCCTGCTTTAGCTTCCCGTTAACCGGGCTTTCCAGCTGTACTTAA
AACGGCGGTAGGGTGGTGAAACCATATTCCTGAAAGGGGTCTCGACATGAAAAGAAAAAGATTGACTCAGTTATTCCCAT
TCCTGCTGCCGGTCCGCAGGATACAACGGAAATTATGCTTCTATACCAAGATGTACCTTGACCGGAACCACTATGCCAAA
GCAAAGGCTCCAGAGTTTTTGCCTTTTTGCATTTATGAAACCAAGTCGAAGCTTCTCAATGAAAATACCGGCATGGATAT
AAAATACCAGGAGAACAAGGTGTTTAATCTGCGCCTTGCTGCGGAGCCCGTCAATGGCCTATTGATCCGCCCTGGCGAAA
CATTTTCATTTTGGCAGCGGGTGAGATATGCCGAGAAAAATGAGCGGTATAAGGACGGTCTATGCGTGGTCAATGACGAA
TTGGTTACGGTTCCGGGAGGCGGTTTGTGTCATCTCAGCAATTTGCTGTTTTGGCTCTTTCTGCATACTCCCCTCACGAT
TGTCGAACGGCATGCTCATGAGATTAAAGATTTTCCTTCTCCCGATGAGGATGAACCGGATGGTGTGGACGCGACAATCC
ACGAAGGGTGGTTGGATTTAAAGGTCAAAAACGATACCAATCTTACCTTCCAAATTGAACTATCCATTGATGGGCCTTAC
ATCTATGGCCGTATTTTTATGGATCAGGCTAAAGGGTATAGTTACGAGGTTGTTAATCGTGATAAGCGCTTTCTCCAAAA
AGAGGGAAAAATATTTGAGCGGGTTTCCGTTTGCCGGCAGGTGATCGACAACAAATCCAAGCAAGTTATTTCCGAAAATA
TGCTTTATACGGATGTATTTGAAATCGGGTATCCGCTTCCGGAAGGAACTGCTATCGCAGAGGAAAAGGAAATTTGAAAG
GAGAAAGCTTATGAGTAAGTTGAAAATCGCAATTATCTTCGGAGGCTGTTCCGAAGAACATCCCGTCTCCGTTAAATCTG
CTGGGGAGGTGGCCAAAAACCTGGATCTCGAAAAGTATGAACCCTTCTATATCGGGATTACGAAAGATGGGGTTTGGCAG
CTTTGTCACTACCCTGAGGCCAATTGGGAAAAGGGCAGTTGCCGTCCGGCTATCCTGTCACCGGACAGAAGCGTCCAGGG
ATTGCTTGTTCTGGAGCAGGGGCAATACCAAAGGATCCCCTTGGATCTGGTGTTTCCCGTTCTGCATGGCAAATTTGGCG
AGGATGGCGCGATACAGGGTTTGTTGGAGCTTTCCGGCATCCCCTATGTGGGCTGCGATATCCCGAGTTCGGCTCTGTGC
ATGGACAAATCCCTGGCTTATATCGTCGCTGGAAAGGCAGGAATTGCCACGCCAAAGTTCCGGACGGTCACTGCGAAGGA
GACTATTGACGCCGAACGGCTTGCTTATCCCGTTTATGTCAAGCCGGCCCGTTCGGGTTCATCCTTCGGCGTCACTAAGG
TATGCCGCCAAGAAGAATTGCTGAGTGCGGTGGAAATCGCCAGACAGTATGACTCGAAGGTGCTGATTGAAGAGGCTGTC
GTCGGCAGCGAGGTAGGCTGTGCGATATTTGGAAACGATCTGGATTTGATGGCCGGTGAGGTCGATCAGATCTGTCTGTC
TCATGGCTTTTTCAGAATCCATCAGGAGAATGAGCCGGAAAAGGGTTCCGAAAACTCAACACTAATCGTTCCCGCCGACA
TTTCCCCAGAGGCGCGCTCGCGGGTTCAGGAGACGGCAAAAGCCATCTATCGCGCTTTGGGCTGCAGGGGACTGGCGCGG
GTGGATATGTTTCTGAAAGAAGATGGAACAGTAATCCTCAACGAGGTGAATACTTTGCCCGGCATGACCTCATACAGCCG
TTTTCCGAGAATGATGGCGGCCGCAGGCTTGCCCTTTGCCGAAGTGATCGACCGGCTTGTCTCGTTGGCCTTTTAA

>>MEG_7572|Drugs|Glycopeptides|VanM-type_resistance_protein|VANXM
ATGAAAAGTGATTTTGTTTTTGTGGACGAGTTGATATCGGGAATACGTTGGGATGCTAAATACGCCACCTGGGATAATTT
TACCGGCAAACCGGTGGACGGCTATGCCGCCAATCGAATTGTCGGCACGAGAGCGTTGTGCGAAGCCCTGGAAAAAGCAC
GGGAAAACGCCGCATCCTTGGGCTTTGGCTTGCTTCTTTGGGATGGTTACCGCCCTCAATGCGCCGTAGATTGCTTTCTG
CGCTGGTCTAAACAGCCGGAAGATGGTCGGACGAAACAAAAACACTATCCGAATATTGACCGCTCCGAGATCATCGAAAA
AGGATATGTGGCTGCCAAGTCGGGCCACAGCCGGGGCGGCGCCATTGATTTAACCCTTTATCATTTAGCTTCCGGAACCC
TTGTGCCCATGGGGGGCGATTTTGATTTGATGGATTCAGTCTCCCATCATGGCGCACATGGAATCAGCCAAGCCGAAGCG
AGAAACCGTCAATATCTTTGCTCGATCATGGAGGCCAGCGGCTTTATTTCCTACGCTTGCGAGTGGTGGCATTACACCCT
GAAACACGAACCTTATCCCAATACTTACTTTGATTTTCTCATTGCCTAGTTGAGTATCAAGCGTGATGACGAGAACTGTG
AGGTGCTTTTGACAATGGAAATGACAGTACGCGAAATCGTTGCCGCCTGCGGCGGAAAATTACTCTGCGGGGACCCGGAT
ACGATGGTGACCTCGGTGGTGACCGACAGCCGGAAAGTGACCGACGGTTCCCTGTTTGTCCCCCTCAAAGGCGAAAAGGC
GGACGCCCACACCTTTCTGCACGCCGCATTCGCCTCGGGTGCAGCCGCGGCACTGACCCAGGAGCATACGCGGATGGAGG
CGGAAGAAGCCTGGATCGCGGTGGATTCGACTCAGCTGGCGCTCCAGCACATTGCCGCCGCCTATCGGCAGAGATTTTCC
ATCCCTGTGGTTGGGATCACAGGGAGCGCCGGGAAGACGACGACGAAAGAAATGACCGCGCTGGCACTTTCCGCAGGATA
CAAGGTGATGAAGACGGGAGGAAACCATAACAGCCAGATCGGACTGCCCCTGATGATGTTTCAGTTTTCCAGGGAACACG
AAGCGGCGGTGGTGGAGATGGGGATAAGCGATTTCGGCGAAATGGCGCGCCTGGCTCAGGTCGCCGAGCCGAAGTACGCC
GTCATGACCAACCTCGGCATTACTCACATCGGCCAGCTCAAAACCCAGGAGAACATCCTGCGGGAGAAGCTGCACATCAC
GGACCGGTTCACTCAGGGTTCCGTTCTGTTTTTAAACGGGGACGATCCAATGCTGGCCGGACTCCGCGGCAAGACAGGGT
ATGAGGCCGTCTTTTACGGCACAGCGCCCTGGTGCGATTTCCGCGCAGAGGGGATTACGGTTCAAGGGGAAACCACCGCT
TTCCGCTGCCTTGCTCCGGGGAGAGAGAGCGTGGAGGTGATCCTGCCGGTACTGGGAATGCACCATGTTCTGGATGCCCT
GGCCGCCCTGGCCGTGGCGGAGCGGCTGGGCGTGCCCCTGGACCGGGCCGCCGCCGCGCTGGGGGATTACCGCCCCCTGG
CCATGCGCCAGCAGATATACCATGTCAACGAGGTCGCTGTCATTGATGATTCTTACAACTCCAGTCCCGGCGCGGCCAAA
AGCAGCCTGAGTGTCCTTGCGGGGTTCCGGGCCGGCCGCAGAGTAGCCGTGCTGGCGGATATGCTCGAACTGGGGGAGTA
TTCCCGGCAGGCCCATTTTGAAGTCGGTGTCTGCGCCGCGGAAAGCGGAGTGGATATTTTACTGACCGTCGGTCCGGAGG
CGAAAGCCGTGGCCGAGGGTGCCCGCTCCGTCCGGTCCGGGATCGACTGCCGCGTTTTTGACCATAACCGTCAGGCCGCG
GCGGAGTTGAAATCCTTTCTGTCTCCCGGTGACGCAGTTCTGGTCAAAGGCTCCCGCGGTATGCATACGGACGAAATCGT
CCGCGCCCTGCTGCAGTTTCCCGCTTCGGTAGGGACAGTCCGGCCGGCCCAATAATCCCCGCCTGAAAAATATGAAAGAA
AACCCGGCTTATAATGGAGTGTTTTTAAAATGTTAAACGTTGACAAGATAAGTGAAGAAACCTATTATGCGTTCATTTCT
CAAGCGGATCTAGGCAATTTTATGCAGTATCCTTCCTGGGCCAAGGTCAAAACTGAGTGGACCAGCGATTTATTGGGGTG
GTTCACCCCGGACAATAAATTGGCAGGGTGTGGTTTGATCTTATACCGGAAAATGCCCTGCCTTAACCGGTACCTGGCGT
ATTGTCCCCGCGGTCCCCTTATTGACTGGCAGAGCCCCAACCTCAGGGAATGGTTCGAACCTCTTGTGGCTTATTTGAGA
AGCAAGCAGGTTTTCAGTATCAAGATCGATCCTCCGGTGGTCCAGGCAAAATGGTCTGCCCCCACCATTAAAACGTTTTT
AGGGCAAGCCCGTGAACAGGGCAGCAAAGGGAAAGTTTTGCGCGATTTGCCGCCGGACGAAGACTACACAACGGTCCAAC
AAGTGCAGCAGCAATTACGGCAAATGGGTTGGCGGAAGCAGCGGGGGGATACGGGTTTCGCTGCGACCCAGCCCCAATAT
GTTTACCGCCTGCCCTTAGAGGGGCGCAGCCTGGAGGAGGTCTTCGCCGGTTTTCATACCAACTGGAGGCGCAATGTTAA
AAAGGCCGAGCGTTTGGGCGTCAAGGTCCGGGTCGGGACCGAACAGGATTTACCGGCTTTTTATGAGCTGCTGAAGGTAA
CTTCAGAACGGGATCACTTCAAGGTGCGCAGTTTCTCCTACTTTTCCAATCTGTACCGGTCCTTAAAGGCTGAAGCGGCA
GACCGTATTGCTCTTTATCTGGCGGAAGATGAAGAGGAATTATTGGCTGCTACCTTAGCCGTCCATTCCAACGCCCACTC
ATGGTATCTTTACGGGGCCAGCAGCAATGTAAAACGGGAGAAGGCCCCGAATCATGCTATCCAGTGGCGGATGATTCAAG
ATGCTTATCAGCTTAAGGCCTACACCTATGATTTTAGAGGCATCAGCCCTACCCTGGATGAATCTGACCCCCTGTTTGGG
TTGTTGAGATTTAAATTGGGCTTTGGAGGCGAGGCTTGTGAAATGATCAGTGCTTGGGACTACCCCCTGCAGCCTTTATT
ATACCGGGCTTTCCAGCTGTACTTAAAACGGCGGTAGGGTGGGCCATATTCCTGAAAGGGGTCTCGACATGAAAAGAAAA
AGATTGACTCAGTTGTTCCCATTCCTGCTGCCGGTCCGCAGGACCCAACGGAAATTATTCTTCTATACCGAGATGTACTT
TGACCGGAACCACTATGCCAAAGCAAAGGCTCCGGAGTTTTTGCCTTTTTGCGTCTATGAAACCAAGTCGAAGCTTCTCA
ATGAAAATACCGGCATGGATATGAGATACCAGGAGAACAAGGTGTTTAATCTGCGCCTTGCCGCGGAAACTGTCAATGGC
CTATTGATCCGCCCTGGTGAAACATTTTCATTTTGGCAGCGGGTGAGATATGCCGAGAAAAATGAGCGGTACAAGGACGG
TTTGTGCGTGGTCAATGATGAATTGATTACGGTTCCGGGAGGCGGTTTGTGTCATCTCAGCAATTTGCTGTTCTGGCTGT
TTCTGCATATGCCCCTTACGATTGTCGAACGGCATGCTCATGAGATTAAGGATTTTCCTTCGCCGGATGAGGATGAACCG
GATGGTGTGGACGCCACAATCCACGAAGGGTGGTTGGATTTAAAGGTCAAAAACAATACCAATCTTACCTTCCAAATTGA
AATAGCCATCGATGAGCCTTACATCTATGGCCGTATTTTTATGGATCAAGCCAAAAGGTATAGTTACGAGGTCGTTAATC
GGGATAAGAGCTTTTTTAAAAAGGAGGGAAAAACCTTTGAGCGGGTTTCGGTTTGCCGGCAGGTGATCGACAACGAATCC
AAACAGGTTGTTTCCGAAAAACTGCTTTATACGGATGTATTTGAAATCGGGTATGTGCTTCCGGAAGGAACGGCTATCGC
AGACGAGAAGGCGTGATGGAAAGCGCTAAGCCGGCGGTGCAGTCTTAGATGCTCGCAGGAGAGGGTCTGCCCCCCCCCCA
TGGCACAGAACACGCCCTGAGGGATACTGTTTTGAAAAGACTATGATTGCCTGAAATATGAAAGGAGAAAACAGCATGGA
TCGGTTGAAAATCGCAATTATTTTCGGAGGCTGTTCCGAAGAACATCCCGTCTCCGTTAAATCGGCTGGGGAGGTTGCCA
AAAACCTGGATCTCGATAAGTATGAACCCTTCTATATCGGGATTACGAAAAATGGGGTTTGGCAGCTTTGCCGCTACCCT
GAGGCCAATTGGGAAAACGGCATTTGCCCTTCGGTTATCCTGTCACCGGACAGAAGCCTCCAGGGATTGCTTGTTCTGGA
GCAGGGACAATATAAAACGATTCCTTTGGATCTGGTGTTTCCCGTTCTGCATGGTAAATTTGGCGAGGATGGGGCGGTGC
AAGGTTTGTTGGAGCTCTCCGGCATCCCCTATGTGGGCTGCGATATCCCCAGTTCGGCCTTGTGCATGGACAAATCCCTT
GCTTATATCGTCGCCGGAAACGCAGGAATTGCCACGCCAAAGTTCCGGACGGTCACGGCGAAAGAGGCCATTGATGCCGA
ACGGCTTGCTTATCCCGTTTATGTCAAGCCGGCCCGTTCGGGTTCATCCTTCGGCGTCACTAAAGTATGCCGCCAAGAAG
AATTGCTGAGTGCGGTGGCAATCGCCAGCCAGTATGACTCGAAGGTGCTGATTGAAGAGGCTGTCATCGGCACTGAGGTA
GGGTGTGCAATATTTGGCAACGATCTGGATTTAATGGCCGGGGAGGTCGATCAGATTCGCCTGTCTCACGGCTTTTTCAG
AATCCATCAGGAGAATGAGCCGGAAAAGGGTTCCGAAAACTCAACCCTAATCGTTCCCGCCGACATTTCGCCGCAGGCGC
GTTCGCGGGTTCAGGAGACGGCAAAAGCCATCTATCGCGCTTTGGGATGCAAGGGACTGGCACGGGTGGATATGTTCCTG
AAGGAAGATGGAGAAGTAATCCTGAACGAGGTGAATACTTTGCCCGGTATGACCTCGTACAGCCGTTTTCCGAGGATGAT
GGCGGCCGCAGGCTTGCCCTTTGCCGAAGTGATCGACCGGCTTGTCTCGTTGGCCTTGCAAGGAAAAACAGGAGCCTTAT
CCCAACACTTACTTTAA