MEGAResFrom MEG, the Microbial Ecology Group

VANXM

The vanX gene encodes a dipeptidase. This gene is part of the VanM operon and is a core resistance gene.

References

Other Groups in VanM-type resistance protein

Sequences

Download Sequences

>Gly|VanX-M|FJ349556|5894-6502|609|Glycopeptides|VanM-type_resistance_protein|VANXM
ATGGAAAAAGGATTTACCTTTTTAGATGAAATATTAAACGATGTTCGTTGGGACGCTAAATATGCTACGTGGGACAACTT
CACTGGAAAACCAATTGATGGATATGAAGTAAATCGAATTATAGGAACATATGAGTTAGCCGATGCGCTATTGAAGGTTC
AAGAATTAGCTTTTAACCAAGGTTATGGATTGCTTTTATGGGACGGTTACCGTCCCCAACAAGCTGTAAATTGTTTTTTG
CAATGGGCGGCACAGCCGGAAGATAATCGAACAAAGGCAAAATATTATCCCAATATTGACCGAACTGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGTCATAGCCGCGGAAGTGCAATTGATCTTACACTTTATCGATTAGACACGGACGAAC
TTGTTCCGATGGGGAGCGGATTTGATTTTATGGATGAGCGCTCTCATCATGAGGCAAAAGGAATTACGAGCAATGAAGCG
CAAAACCGTAGATTTTTGCGTTCCATTATGGAAAACAGTGGGTTTGAAGCGTATAGTTTCGAATGGTGGCACTATGTATT
GATAAACGAACCTTATCCCTATAGCTGCTTTGATTTTCCTGTCAAATAA