MEGAResFrom MEG, the Microbial Ecology Group

VANHM

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanM operon and is a core resistance gene.

References

Other Groups in VanM-type resistance protein

Sequences

Download Sequences

>Gly|VanH-M|FJ349556|3884-4864|981|Glycopeptides|VanM-type_resistance_protein|VANHM
ATGGTCTTAGTAATGAAAGATATCGGCATTACCATTTATGGATCTGAGCAGGATGAGGCTGATGTGTTCCAGGAAATTTC
ATCTCGATTTGGCGTTACACCTACCATTGTAAGCTCTCCTATATCAGAAACCAACGTAATGTTAGCCCCTAAAAATAAGT
GTATCAGCGTGGGGCACAAGTCTGAGATTCACAAATCTATCCTTATTGCATTGAAGGAATCCGGCGTCAAATATATCTCT
ACTCGAAGTATTGGTTACAATCATATAGATATGAAGGCAGCGGAAAAAATGGGTATTGCTGTCGAGAACGTCACTTATTC
ACCAGATAGTGTTGCCGATTATACATTGATGCTGATACTTATGGCAATACGCCATACGAAATCTACTTTGTGCTCTATGG
AAAAACATGATTTCAGACTGAACAGCGTCCGTGGTAAAGTACTGCGTGACCTGACAGTAGGTGTACTGGGAACCGGTCAT
ATAGGCAAAGCGGTTATTGAGCGACTACAGGGGTTTGGAGGTCACGTGTTGGCGTACGGCAACAACAAAGAGGCGACGGC
AAATTATGTATCCTTCAATGAATTACTGCAAAAAAGTGACATTCTAACCATTCATGTACCCCTTAGCGATGACACATACC
ATATGATCGGTCACGAACAGATTAAAGCAATGAAACAGGGCGCCTTTCTTATTAATACTGCTCGAGGTGGACTTATAGAT
ACCGAAGTTCTGGTTAAAGCACTGGAGGACGGAAAACTGGGGGGCGCCGCATTAGATGTATTAGAGGGAGAAGAAGGGCT
TTTCTACTTTGATTGCACCCAAAAGCCAATTAACAATCAATTTTTGCTGAAACTTCAAAGGATGCCAAATGTGACAATCA
CACCGCATACGGCTTACTATAGCGAAAAAACGTTACGTGATACTGTTGAAAAAACAGTCAAGAACTGTTTGGAATTTGAG
AGGAGAGAGACACATGAATAG