MEGAResFrom MEG, the Microbial Ecology Group

VANSM

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanM operon and is a regulator gene.

References

Other Groups in VanM-type regulator

Sequences

Download Sequences

>CARD|phgb|FJ349556|1672-2785|ARO:3002939|vanSM|Glycopeptides|VanM-type_regulator|VANSM
ATGGCTAAAATGAGAAGCAGTTTTCGCACCAAAATCATCTTGTTATTTGCTGTAAGCATGCTTCTGGCTGGTATGGTAAC
TTACTTACTTTTTAAAGGACTACAGCTTTATTATCATACTATGATTCATCGTGGTAACCCATTAGCCGAACTTCGCGATT
TCATAGAGAGTATTGGAGACTTTAACTTCTTTTTCCTATTATTTATCTTACTGTCGCTGTCGGTTTTCTATATACTCACT
AAGCCCTATTCTGCTTATTTCGATGAAATATCAACCGGAATTCAATACCTCGCACTTGGCGACTTTAAACGCCGGGTTAA
TATCCAATCAAATGATGAATTTGGGGATATTGCTCAAGCTATTAATCAGGCAAGTGAAAAATTAGAAGAAGCCATACAAA
GAGGTGATTTTTCAGAAAACAGCAAAGAACAATTAGTTGTAAATTTGGCTCATGATTTGCGTACGCCGCTAACTTCTGTT
TTAGGTTATTTAGATTTAGTTCTTAAGGATGAGAAGTTGACAAAAGAACAAGTCAGGCATTTTTTAACGATCGCCTTTAC
GAAATCACAGCGTTTAGAAAAACTGATTGATGAATTATTCGAAATCACGAGAATGAACTATGGCATGCTATCAATTGAAA
AAAAGCCAATTAATTTAACTGATCTGCTTCTTCAATTGAAAGAAGAATTGTATCCGATTTTCGAGAAAAACGGTTTGACC
GCTCGAATGAATACACTGCCTCATTTACCTGTTTCGGCTGATGGAGAGATGTTGGCTCGAGTGTTTGAAAATCTGTTGAC
CAATGCCAATCGTTACGGACATGACGGTCAGTTTGTAGATATTAATGGGTTTGTTGATGAAGAAGAAGTGGTTGTTCAAG
TTGTGAATTATGGAGATAGCATTCCTCCGAACGAACTTCCGTATCTTTTTGATATGTTCTATACCGGTGATAAAGCACGA
ACCCATAAAGAGGATAGCACTGGTCTTGGACTATTTATTGCGAAGAATATTGTGGAACAGCATAATGGAACGGTTACGGC
TGAAAGCAGTCTAATACGTACGGTATTTGAAGTTCGTTTACCGCTGGAAAGTGCTCCTATTGACCAAGTTTAAA