MEGAResFrom MEG, the Microbial Ecology Group

VANRM

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanM operon and is a regulator gene.

References

Other Groups in VanM-type regulator

Sequences

Download Sequences

>297|FJ349556.1|FJ349556|Glycopeptides|VanM-type_regulator|VANRM
ATGAGACGTATATCGATTTTAATTGCTGAAGATGAAGAAGAAATTGCTGATTTGCTTGCCATTCACCTGGAAAAAGAAGG
ATATGACGTTATTAAAGTACATGACGGACAAGAAGCCCTCCATGTAATCCAGGCTCAATCAATTGATTTGATAATTTTAG
ATATTATGATGCCGAAAATGGATGGATATGAAGTAACCCGTCAAGTCCGTGCACAGTATAATATGCCAATCATTTTTTTA
AGTGCGAAAACTTCTGATTTCGATAAGGTGCATGGTCTAGTGATTGGAGGGGATGATTATATAACAAAGCCATTTACCCC
GATTGAATTGGTTGCTCGTGTGAACGCTCAATTGCGGCGCTCTATGAAGTTGAATCACCCCCAAGCAGATGATAAAAAAT
CTATCTTGGAGTTCGGTGAGATCGTGATTTCTCCTGATCAACGTACAGTTTTTCTTTATGGTGAAAACATCGGGTTAACG
CCGAAAGAGTTTGATATTTTGTATTTATTAGCCAGTCATCCAAAGAAAGTTTATAGTGTCGAAAATATTTTCCAGCAAGT
TTGGAATGATGCATACTTTGGAGGCGGTAATACGGTAATGGTGCATATTCGCACCTTGCGGAAAAAACTTGGAGAAGATA
AGCGAAAAAATAAGTTAATCAAAACTGTGTGGGGAGTGGGGTATACGTTCAATGGCTAA