MEGAResFrom MEG, the Microbial Ecology Group

VANYM

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanM operon and is an accessory gene.

References

Sequences

Download Sequences

>299|FJ349556.1|FJ349556|Glycopeptides|VanM-type_accessory_protein|VANYM
ATGGTCTTTCAAGGAAACTTACTCTTGGTTAATAACGAATATCCGGTTCTCGAAGAGAGTATAAAAACAGACGTTGTAAA
TTTATTTAAACATGATGAATTGACAAAAGGATATGAATTGCTCAATAGGGAAATTTATTTATCGGAGAAAGTTGCCCGTG
AATTTTCAGAGATGGTAGATGCGGCTGAAAAAGAAGGAGTTCGCCATTTTTCAATCAATAGTGGGTTTCGAAACTTTGAT
GAGCAAAATGCCCTTTATCAAGAAATGGGGTCTGACTACGCCTTGCCTGCAGGTTATAGCGAACATAATTTAGGTTTAGC
ACTTGATATCGGATCTACTCAAATGGAAATGAGTGAGGCACCGGAAGGAAAGTGGCTAGAAGATAATGCGTGGGAATACG
GCTTTATTTTACGCTATCCAATGGACAAAACGGCCATCACAGGTATTCAGTATGAACCTTGGCATTTTCGCTATGTGGGA
TTACCGCACAGTGCAATTATAGAGGAAAAGAATTTTGCTTTAGAAGAATATTTGGATTTCCTAAAAGAACAAAAATCCAT
TTCAGGTACTATACATGGCGAAAATTATGAGATTTCTTATTATCCTATTACCGAAAAAACAGACATTGAAATGCCTGCCA
ATCTTCATTATGAAATATCAGGAAACAATATGGATGGTGTGATTGTGACAGTGTATCGCTAA