MEGAResFrom MEG, the Microbial Ecology Group

VANXYL

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanL operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>>MEG_7590|Drugs|Glycopeptides|VanL-type_resistance_protein|VANXYL
ATGGATAACGATTACAAGTATTATTTACAATTAGTCAATAAGCAATATCCTTGGCAGATAAACAATGGTTCTAAAAAAAT
GGTAAGGGTGCCTTATACAGATAAAGAAATTTATTTAGATGCAGTTGTTGTTGAACATTTGATTCAGTTGATCGAAACTA
TTCAATTACAAGAGAAAATAGAAATAGTTGATGGTTACCGTACGATAGACGAACAAAAAGAATTATGGGAATTTTCTTTA
AAAGATAGAGGGAAACGATATACTCATGATTATGTTGCCTATCCTGGGTGTAGTGAGCATCATACTGGACTTGCATTAGA
TATTGGTCTTAAAAAAACAGCACATGATATCATAGCACCAAAATTTAATGGAGAAGAGGCAAAAAAATTTTTAGAGCATA
TGAAAGATTACGGATTTATTTTAAGGTACCCTCCAAACAAAAAAAAGGTAACAGGGATTGCGTATGAACCGTGGCATTTT
AGGTATGTTGGAGTTCCTCACAGCCAAATCATTACTCAGCAAGCTTGGACGCTGGAAGAATATATCGCTTTTTTACACAC
AGTAGGAGAAAAAGTTTCATGA