MEGAResFrom MEG, the Microbial Ecology Group

VANXYL

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanL operon and is a core resistance gene.

References

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>CARD|phgb|EU250284|1996-2578|ARO:3002968|vanXYL|Glycopeptides|VanL-type_resistance_protein|VANXYL
ATGGATAACGATTACAAGTATTATTTACAATTAGTCAATAAGCAATATCCTTGGCAGATAAACAATGGTTCTAAAAAAAT
GGTAAGGGTGCCTTATACAGATAAAGAAATTTATTTAGATGCAGTTGTTGTTGAACATTTGATTCAGTTGATCGAAACTA
TTCAATTACAAGAGAAAATAGAAATAGTTGATGGTTACCGTACGATAGACGAACAAAAAGAATTATGGGAATTTTCTTTA
AAAGATAGAGGGAAACGATATACTCATGATTATGTTGCCTATCCTGGGTGTAGTGAGCATCATACTGGACTTGCATTAGA
TATTGGTCTTAAAAAAACAGCACATGATATCATAGCACCAAAATTTAATGGAGAAGAGGCAAAAAAATTTTTAGAGCATA
TGAAAGATTACGGATTTATTTTAAGGTACCCTCCAAACAAAAAAAAGGTAACAGGGATTGCGTATGAACCGTGGCATTTT
AGGTATGTTGGAGTTCCTCACAGCCAAATCATTACTCAGCAAGCTTGGACGCTGGAAGAATATATCGCTTTTTTACACAC
AGTAGGAGAAAAAGTTTCATGAA