MEGAResFrom MEG, the Microbial Ecology Group

VANTRL

The vanTrL gene encodes an enzyme that functions as the racemase portion of the vanT gene. This gene is part of the VanL operon and is a core resistance gene.

References

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>CARD|phgb|EU250284|3557-4658|ARO:3002974|vanTrL|Glycopeptides|VanL-type_resistance_protein|VANTRL
ATGGTAGAAAACAAAATGAGAGCCTACAAAGAATTCTATGTAGAATCATTGTTGCATAATGTACAAGTTATCAAAAAAAA
CATACCCAAGTCTACTAAAATAATGGCAGTAGTGAAAGCAAATGCCTATGGAATAAATGCAGTGAATGTAGCTATTATCT
TAGAATATATAGGAATTGACTTTTTTGCAGTTGCTACTATAGATGAAGCTATTGCTTTAAGAAAAAATGGCATTACAAGT
AATATTTTAATTTTAGGATACACTACACCAACCAAGGTAGATGATCTTATCCATTACGAACTTACCCAAACAATAGTAAG
CAAAGAACACGCGTATTTTCTTAATAAAACAGGAAAGAAGATAATGTGTCATTTAAAAGTCGACACAGGGATGCATCGGT
TAGGTGTTGAACCTACGTTAGAAGAAATCTGTCCTATTTTTAACTACCCTTTTTTAAAGATAAAGGGTGTTTATTCTCAC
TTGGGCTCAGCAGACGATTTATCTGAGGAAGGCAAACAACGAACTATAAAACAAATTAGCCGATACAATACCATTATTGC
AGAATTAAAACGAAAACGTGTTGACGTAGGGCTAACCCATCTCCAAAGTAGTTATGGTATACTTAATTATTCTGAGTTAG
CGTATGACTATGTTCGTCCTGGAATTATTTTATATGGGCTTTTAAGTAATAATGACCACAACGTCAAATTGCATTTGGAT
CTCCAGCCTGTAGTAGCGGTTAAAGCTCAGTTAATTTCAAAAAAAAAGATAGCTCCTGGTGAATATATTGGCTACGGTAC
AGATACACAATTAACTTCTTCCAAAACTATAGGGGTATTAAGCATTGGGTATGCTGACGGAATCCCTAGAAATTTATCAA
ATGGAGAATATTGTGTCGTGTTTGAAGATAAGCAAATCCCTCAAATTGGACGTATTTGTATGGACATGATGTTAGTAGAT
TTGTCAAATTGTTCAGATATCCCTTTAGGTGTAATGGTTGATGTATTACCTAATATTGAAGAAATATCTCAAATCCAAAG
CACCATAACGAATGAAATAATAAGTTGTTTGGGTAGTCGCTTGGGGATGGAAGTAAAGTAAA