MEGAResFrom MEG, the Microbial Ecology Group

VANTML

The vanTmL gene encodes an enzyme that functions as the membrane-binding portion of the vanT gene. This gene is part of the VanL operon and is a core resistance gene.

References

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>CARD|phgb|EU250284|2574-3564|ARO:3002973|vanTmL|Glycopeptides|VanL-type_resistance_protein|VANTML
ATGAAAAAACAAAATACGGGTGTAAATAATTTCCGTTTAATCGCTGCTGCCATGGTAGTAGCGATTCATTGCTTTCCATT
TCAAACAATCAGTAAAGAACTAGATACATTGGTTACGCTAACTGTCTTTCGTATTGCCGTTCCTTTTTTCTTCATGGTTT
CTGGGTACTACCTACTAGGTCCAATTCCAAGTTCAGCCACAAATACTTATCAAATTAATAACTATATAAAGAAACAGCTT
AAAGTTTATACTTTCGCTATAGTTCTGTATCTACCTTTAGCGTTTTATAGTCAATCTATCACTTTGGATATGTCAATTAT
TAGTTTTATAAAACAACTACTTTTTAACGGTTTTTTTTACCATCTTTGGTTTTTCCCTGCATGGGTATTAGGATTATTAA
TTGTTCAATTTTTATTAAAAAGAATGAATATACAGACTGTATTGTTTATAACATTTGTGGCTTATTTAATAGGACTAGGA
GGGGATAGTTGGTGGGGAATAGTTAAACAAGTTCCCTTTTTTTTCAGATTTTACAATGCTATATTTCAATTATTTGGTTA
TACACGAAATGGTCTATTTTATGCGCCGTTATTCTTTGCACTGGGAGCATATCTATACAAGATGAATATTAAAAACTTTA
ATTCCGCAAGAAATAACTATCTTTTACTGCTTTTTAGTATAGAAATGATTTTAGAAAGTTATTTCTTACATCTCTTTAAC
ATTCCTAAACATGACAGTATGTATTTGTTTTTACCGTTTGTAATGACTTTGGTGTTTATCAAAATATACAATTGGTCACC
AAAAAATAATTTATTGAACAGCTCTCAGCTATCTCTAGGAGTATATCTTATACATCCATATATCATCGCAGTAATTCACT
CTATCTCAATTTACGTTTCTATTTTTACTAATAGCATAATTAATTATTTAAGTGTGCTATTGATAAGTTACCTAACTATA
AGACTAATACTAAAAAGGAAGGAATGGTAGA