MEGAResFrom MEG, the Microbial Ecology Group

VANTML

The vanTmL gene encodes an enzyme that functions as the membrane-binding portion of the vanT gene. This gene is part of the VanL operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>>MEG_7533|Drugs|Glycopeptides|VanL-type_resistance_protein|VANTML
ATGAAAAAACAAAATACGGGTGTAAATAATTTCCGTTTAATCGCTGCTGCCATGGTAGTAGCGATTCATTGCTTTCCATT
TCAAACAATCAGTAAAGAACTAGATACATTGGTTACGCTAACTGTCTTTCGTATTGCCGTTCCTTTTTTCTTCATGGTTT
CTGGGTACTACCTACTAGGTCCAATTCCAAGTTCAGCCACAAATACTTATCAAATTAATAACTATATAAAGAAACAGCTT
AAAGTTTATACTTTCGCTATAGTTCTGTATCTACCTTTAGCGTTTTATAGTCAATCTATCACTTTGGATATGTCAATTAT
TAGTTTTATAAAACAACTACTTTTTAACGGTTTTTTTTACCATCTTTGGTTTTTCCCTGCATGGGTATTAGGATTATTAA
TTGTTCAATTTTTATTAAAAAGAATGAATATACAGACTGTATTGTTTATAACATTTGTGGCTTATTTAATAGGACTAGGA
GGGGATAGTTGGTGGGGAATAGTTAAACAAGTTCCCTTTTTTTTCAGATTTTACAATGCTATATTTCAATTATTTGGTTA
TACACGAAATGGTCTATTTTATGCGCCGTTATTCTTTGCACTGGGAGCATATCTATACAAGATGAATATTAAAAACTTTA
ATTCCGCAAGAAATAACTATCTTTTACTGCTTTTTAGTATAGAAATGATTTTAGAAAGTTATTTCTTACATCTCTTTAAC
ATTCCTAAACATGACAGTATGTATTTGTTTTTACCGTTTGTAATGACTTTGGTGTTTATCAAAATATACAATTGGTCACC
AAAAAATAATTTATTGAACAGCTCTCAGCTATCTCTAGGAGTATATCTTATACATCCATATATCATCGCAGTAATTCACT
CTATCTCAATTTACGTTTCTATTTTTACTAATAGCATAATTAATTATTTAAGTGTGCTATTGATAAGTTACCTAACTATA
AGACTAATACTAAAAAGGAAGGAATGGTAG