MEGAResFrom MEG, the Microbial Ecology Group

VANL

The vanL gene encodes a D-ala-D-ser ligase. This gene is part of the VanL operon and is a core resistance gene.

References

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>CARD|phgb|EU250284|954-2004|ARO:3002910|vanL|Glycopeptides|VanL-type_resistance_protein|VANL
ATGATGAAATTGAAAAAGATAGCCATAATATTCGGAGGTCAATCTTCGGAATATGAAGTCTCACTTAAATCAACAGTAAG
TGTACTAGAAACTCTATCAACTTGTAATTTTGAAATTATAAAAATAGGAATTGATTTAGGCGGAAAGTGGTATCTCACCA
CAAGCAACAACAAAGATATTGAATATGATGTTTGGCAAACTGATCCTTCATTACAAGAAATAATCCCATGTTTCAATAAT
CGAGGCTTTTATAACAAAACTACAAATAAATATTTCAGACCAGATGTACTCTTTCCAATTCTTCATGGGGGGACTGGAGA
AGATGGAACCCTCCAAGGTGTATTTGAATTAATGAATATTCCTTACGTTGGATGTGGGGTGACGCCTTCGGCTATTTGTA
TGGACAAATACTTATTGCATGAGTTTGCTCAGAGTGTGGGTGTAAAAAGTGCCCCTACGCTCATAATTCGCACTAGAAAC
TGCAAAGATGAAATTGACAAGTTCATAGAAAAAAATGACTTCCCTATTTTTGTAAAGCCTAACGAAGCGGGCTCATCAAA
AGGAATAAACAAAGTAAATGAGCCAGATAAGCTAGAGGATGCTTTAACAGAAGCGTTTAAGTATAGTAAAAGTGTTATCA
TTCAGAAAGCTATAATTGGAAGAGAAATTGGCTGTGCTGTCTTAGGTAATGAAAAACTCCTAGTAGGAGAATGTGATGAA
GTTTCCCTTAATAGCGATTTTTTTGATTATACCGAGAAATACCAAATGATCTCAGCAAAGGTAAATATACCTGCTTCTAT
ATCTGTAGAATTTTCTAATGAAATGAAGAAACAAGCTCAGCTGTTATATAGGTTACTAGGCTGTTCAGGACTAGCACGAA
TTGATTTCTTCTTATCAGATAATAACGAAATACTATTAAACGAAATTAATACTTTGCCTGGTTTTACTGAGCATTCCAGA
TATCCCAAAATGATGGAAGCTGTAGGTGTTACCTATAAAGAGATTATCACGAAGTTAATCAATTTAGCGGAGGAAAAATA
TTATGGATAAC