MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANL

The vanL gene encodes a D-ala-D-ser ligase. This gene is part of the VanL operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanL-type resistance protein

Sequences

Download Sequences

>>MEG_7444|Drugs|Glycopeptides|VanL-type_resistance_protein|VANL
ATGATGAAATTGAAAAAGATAGCCATAATATTCGGAGGTCAATCTTCGGAATATGAAGTCTCACTTAAATCAACAGTAAG
TGTACTAGAAACTCTATCAACTTGTAATTTTGAAATTATAAAAATAGGAATTGATTTAGGCGGAAAGTGGTATCTCACCA
CAAGCAACAACAAAGATATTGAATATGATGTTTGGCAAACTGATCCTTCATTACAAGAAATAATCCCATGTTTCAATAAT
CGAGGCTTTTATAACAAAACTACAAATAAATATTTCAGACCAGATGTACTCTTTCCAATTCTTCATGGGGGGACTGGAGA
AGATGGAACCCTCCAAGGTGTATTTGAATTAATGAATATTCCTTACGTTGGATGTGGGGTGACGCCTTCGGCTATTTGTA
TGGACAAATACTTATTGCATGAGTTTGCTCAGAGTGTGGGTGTAAAAAGTGCCCCTACGCTCATAATTCGCACTAGAAAC
TGCAAAGATGAAATTGACAAGTTCATAGAAAAAAATGACTTCCCTATTTTTGTAAAGCCTAACGAAGCGGGCTCATCAAA
AGGAATAAACAAAGTAAATGAGCCAGATAAGCTAGAGGATGCTTTAACAGAAGCGTTTAAGTATAGTAAAAGTGTTATCA
TTCAGAAAGCTATAATTGGAAGAGAAATTGGCTGTGCTGTCTTAGGTAATGAAAAACTCCTAGTAGGAGAATGTGATGAA
GTTTCCCTTAATAGCGATTTTTTTGATTATACCGAGAAATACCAAATGATCTCAGCAAAGGTAAATATACCTGCTTCTAT
ATCTGTAGAATTTTCTAATGAAATGAAGAAACAAGCTCAGCTGTTATATAGGTTACTAGGCTGTTCAGGACTAGCACGAA
TTGATTTCTTCTTATCAGATAATAACGAAATACTATTAAACGAAATTAATACTTTGCCTGGTTTTACTGAGCATTCCAGA
TATCCCAAAATGATGGAAGCTGTAGGTGTTACCTATAAAGAGATTATCACGAAGTTAATCAATTTAGCGGAGGAAAAATA
TTATGGATAA

>>MEG_7445|Drugs|Glycopeptides|VanL-type_resistance_protein|VANL
ATGATGAAATTGAAAAAGATAGCCATAATATTCGGAGGTCAATCTTCGGAATATGAAGTCTCACTTAAATCAACAGTAAG
TGTACTAGAAACTCTATCAACTTGTAATTTTGAAATTATAAAAATAGGAATTGATTTAGGCGGAAAGTGGTATCTCACCA
CAAGCAACAACAAAGATATTGAATATGATGTTTGGCAAACTGATCCTTCATTACAAGAAATAATCCCATGTTTCAATAAT
CGAGGCTTTTATAACAAAACTACAAATAAATATTTCAGACCAGATGTACTCTTTCCAATTCTTCATGGGGGGACTGGAGA
AGATGGAACCCTCCAAGGTGTATTTGAATTAATGAATATTCCTTACGTTGGATGTGGGGTGACGCCTTCGGCTATTTGTA
TGGACAAATACTTATTGCATGAGTTTGCTCAGAGTGTGGGTGTAAAAAGTGCCCCTACGCTCATAATTCGCACTAGAAAC
TGCAAAGATGAAATTGACAAGTTCATAGAAAAAAATGACTTCCCTATTTTTGTAAAGCCTAACGAAGCGGGCTCATCAAA
AGGAATAAACAAAGTAAATGAGCCAGATAAGCTAGAGGATGCTTTAACAGAAGCGTTTAAGTATAGTAAAAGTGTTATCA
TTCAGAAAGCTATAATTGGAAGAGAAATTGGCTGTGCTGTCTTAGGTAATGAAAAACTCCTAGTAGGAGAATGTGATGAA
GTTTCCCTTAATAGCGATTTTTTTGATTATACCGAGAAATACCAAATGATCTCAGCAAAGGTAAATATACCTGCTTCTAT
ATCTGTAGAATTTTCTAATGAAATGAAGAAACAAGCTCAGCTGTTATATAGGTTACTAGGCTGTTCAGGACTAGCACGAA
TTGATTTCTTCTTATCAGATAATAACGAAATACTATTAAACGAAATTAATACTTTGCCTGGTTTTACTGAGCATTCCAGA
TATCCCAAAATGATGGAAGCTGTAGGTGTTACCTATAAAGAGATTATCACGAAGTTAATCAATTTAGCGGAGGAAAAATA
TTATGGATAACGATTACAAGTATTATTTACAATTAGTCAATAAGCAATATCCTTGGCAGATAAACAATGGTTCTAAAAAA
ATGGTAAGGGTGCCTTATACAGATAAAGAAATTTATTTAGATGCAGTTGTTGTTGAACATTTGATTCAGTTGATCGAAAC
TATTCAATTACAAGAGAAAATAGAAATAGTTGATGGTTACCGTACGATAGACGAACAAAAAGAATTATGGGAATTTTCTT
TAAAAGATAGAGGGAAACGATATACTCATGATTATGTTGCCTATCCTGGGTGTAGTGAGCATCATACTGGACTTGCATTA
GATATTGGTCTTAAAAAAACAGCACATGATATCATAGCACCAAAATTTAATGGAGAAGAGGCAAAAAAATTTTTAGAGCA
TATGAAAGATTACGGATTTATTTTAAGGTACCCTCCAAACAAAAAAAAGGTAACAGGGATTGCGTATGAACCGTGGCATT
TTAGGTATGTTGGAGTTCCTCACAGCCAAATCATTACTCAGCAAGCTTGGACGCTGGAAGAATATATCGCTTTTTTACAC
ACAGTAGGAGAAAAAGTTTCATGA