MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRL

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanL operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanL-type regulator

Sequences

Download Sequences

>>MEG_7483|Drugs|Glycopeptides|VanL-type_regulator|VANRL
ATGACGGATAGAATAGTTGTTGTGGATGATGAACAAGAGATAGCCAATTTGATTACAACTTTTTTAGAAAATGAAGGGTT
TCAAGTAACAACCTTTTATAAAGGAGAAGATTTTTTGACTTATATAGCTAGAGAGTCAATTTCTTTAGCTATATTAGATG
TCATGCTACCTGATATTGATGGGTTTCGAATCTTGCAAGAAATTAGAAAGAATTTTTATTTTCCGGTATTAATGCTTACA
GCTAAGGAAGAAAATATGGACAAGATTATGGGACTAACCTTGGGAGCGGATGATTATATTACTAAACCATTTAACCCAAT
AGAAGTAGTTGCCCGGGTAAAAACACAACTAAGACGAGTCCAAAAGTATAACCGGAAAGTGGAAAATGAATCAGTCATAG
AGTTTAACAAAGACGGACTAACGCTAAAAAAAGACAGTCATCAAGTATTTTTATTTGATAAAGAAATAACTGTAACACCT
ATTGAATTCAATTTGCTTTTATATTTATTTGAACACCAAGGAGTGGTTGTTAGTTCAGAAGAACTATTTGAAGCTGTTTG
GAAAGAGAAATATTTAGAAAATAATAACACAATCATGGCACACATTGCTCGCTTAAGGGAAAAATTAGACGAACAGCCAC
GCAAACCTAAATTCATAAAAACCGTATGGGGGGTAGGATATATTATTGAAAAGTAA