MEGAResFrom MEG, the Microbial Ecology Group

VANRL

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanL operon and is a regulator gene.

References

Other Groups in VanL-type regulator

Sequences

Download Sequences

>CARD|phgb|EU250284|4730-5426|ARO:3002927|vanRL|Glycopeptides|VanL-type_regulator|VANRL
ATGACGGATAGAATAGTTGTTGTGGATGATGAACAAGAGATAGCCAATTTGATTACAACTTTTTTAGAAAATGAAGGGTT
TCAAGTAACAACCTTTTATAAAGGAGAAGATTTTTTGACTTATATAGCTAGAGAGTCAATTTCTTTAGCTATATTAGATG
TCATGCTACCTGATATTGATGGGTTTCGAATCTTGCAAGAAATTAGAAAGAATTTTTATTTTCCGGTATTAATGCTTACA
GCTAAGGAAGAAAATATGGACAAGATTATGGGACTAACCTTGGGAGCGGATGATTATATTACTAAACCATTTAACCCAAT
AGAAGTAGTTGCCCGGGTAAAAACACAACTAAGACGAGTCCAAAAGTATAACCGGAAAGTGGAAAATGAATCAGTCATAG
AGTTTAACAAAGACGGACTAACGCTAAAAAAAGACAGTCATCAAGTATTTTTATTTGATAAAGAAATAACTGTAACACCT
ATTGAATTCAATTTGCTTTTATATTTATTTGAACACCAAGGAGTGGTTGTTAGTTCAGAAGAACTATTTGAAGCTGTTTG
GAAAGAGAAATATTTAGAAAATAATAACACAATCATGGCACACATTGCTCGCTTAAGGGAAAAATTAGACGAACAGCCAC
GCAAACCTAAATTCATAAAAACCGTATGGGGGGTAGGATATATTATTGAAAAGTAAG