MEGAResFrom MEG, the Microbial Ecology Group

VANRI

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanL-type regulator

Sequences

Download Sequences

>MEG_7495|Drugs|Glycopeptides|VanL-type_regulator|VANRI
TTGGCTGCTAATATTTTGATTGTTGATGATGAACAAGCTATTGCCGATTTGGTGGAAGTTTATCTGAAAAATGAGAACTA
TAATCTCTTTAAATTTTATAACGGCAAGGATGCCCTTGACTGTATTGAAAAGGAAAAACTGGATCTCGCCATTTTGGATG
TCATGCTCCCTGATGTAGACGGTTTTTCAATCTGCCGGCAAATCCGGGAAAAGCATAATTTTCCGGTGATCATGCTGACA
GCCAAGGAAGAAGAAATCGATAAGATTACCGGGCTGACCTTAGGCGCGGACGACTATATCACCAAGCCGTTCCGTCCCTT
GGAGCTGATTGCCCGCGTCAAGGCGCAGCTGCGGAGATTTACCAAGTATAATTCTGCAGAGCCAAACCAAGAGGAACACG
TGATTGCCTTTTCCGGCTTGGTCTTAGACATGGATACCCATGAATGTACCTTGAATGAAAAAAAACTATCCCTCACGCCT
ACGGAGTTCTCCATTCTTTGGGTCCTTTGCTCCAACCGCGGCCGGGTAGTCAGTTCGGAAGAATTGTTCAGTGAGGTATG
GGGAGACAAGTATTTCACCAACAGCAATAATACGGTCATGGTGCATATCCGGCATTTAAGGGAAAAAATGCAAGACAGCG
CGGAACATCCTAAATATATCAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAGTGA