MEGAResFrom MEG, the Microbial Ecology Group

VANXI

The vanX gene encodes a dipeptidase. This gene is part of the VanI operon and is a core resistance gene.

References

Other Groups in VanI-type resistance protein

Sequences

Download Sequences

>CARD|phgb|NC_007907|4208791-4209754|ARO:3003725|VanXI|Glycopeptides|VanI-type_resistance_protein|VANXI
ATGCAACAATCAAAGCAAGCATCCAATCGGAGCATCTGGCTCATTGCCCTGGGGGCAGCCATGTGGGGCCTGGACGGGGT
CTTCATCGTATCCTTATTGCAGCATGTGTCATCTTCACAAATCGTCTGGCTGGAGCACCTGTTACTATTTTTATTTGCCG
CACCTGTGCTCATCTGGAAGCGTCAGGAACTGAAACAACTCAATGGCGGAGACTGGCTGGCTGTCTTATTTATCGGCTGG
GGCGGCTCAGCCTTGGCCTCCATTCTGTTCACCGCCGGATTTACTTATGGCAATCCCAATGTGGTCCTTCTCCTGCAGAA
AGTTCAGCCCATTTTTGTTATTCTTCTCGCCTCCTGGATGCTTAAGGAACGGATGAGAAAAGATTTCTATGCCCTGTTTG
TTGTGGCCCTGATCGGCGCCTACCTGCTTACTATCGGCCTGCACCTGCCAACTTCCGAAGTCAGCTTGGCACAGCTGCTC
GGTTCCTTATGTGCCATCGGAGCCGCCGCCCTCTGGGGCGGATCCACCGTCATGGGCAAGCGTCTGATCGGAAAATTATC
CTTCACCACCTTGACTGCCCTGAGATTTGCTGTCGCGCTGCCGCTCTTAACCGTCATTGTCCTGGTACAGCAACCCAACT
GGGCCGACCTCGGTCAAAGTCTCCATCTGGCTCCGGTCTGGGCCAACCTGTTGTACCAGACCCTGGTGCCCAGCCTTTTA
AGCCTCTTGCTCTATTACCGCGGCTTGAACGGCGTCCGGGCTTCCCATGCCACTATTGCCGAACTGGCTTTCCCGGCCAC
CGGCCTGCTTGTAAACTGGCTGATCCTCCACCAAACCATCGATTTGGGGCAATGGCTGGGCTTTGCCATCGTCTGGCTGG
TGGTGCTGCAACTGTCGCGGATGCCTAATGCTCCCAAGTCTGCGGTGAAAACTTCCGAAACAGCCAACCTGGCCGGCCTA
TAG