MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXI

The vanX gene encodes a dipeptidase. This gene is part of the VanI operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanI-type resistance protein

Sequences

Download Sequences

>>MEG_7570|Drugs|Glycopeptides|VanI-type_resistance_protein|VANXI
ATGAAAAGTGATTTTGTCTTTGTGGACGAGTTGGTATCAGGAATACGTTGGGATGCTAAATACGCCACCTGGGATAATTT
TACCGGCAAACCGGTGGACGGCTATGCAGCCAATCGAATTGTCGGTACGAGAGCGTTGTGCGCGGCCTTGGAAAAAGCAC
GGGAAAACGCCGCATCCTTGGGCTTTGGCTTGCTTCTTTGGGATGGTTACCGCCCTCAATGCGCCGTAGATTGCTTTCTG
CGCTGGTCTAAACAGCCGGAAGATGGCCGGACGAAACAGAAACACTATCCGAATATTGACCGATCCGAGATCATCGAAAA
AGGATATGTGGCTGCCAAGTCGGGCCACAGCCGGGGCAGCGCCATTGATTTAACCCTTTATCATTTAGCTTCCGGAACAC
TTGTGCCCATGGGCGGTGATTTTGATTTGATGGATTCAGTCTCACATCATGGCGCACATGGAATCAGCCAAGCCGAAGCG
AGAAACCGTCAATATCTTTGTTCGATCATGGAGGCCAGCGGTTTTGTTTCCTACGCTTGCGAGTGGTGGCATTACAGCCT
GAAACACGAACCTTATCCCAACACTTACTTTGATTTTCTCATCGCCTAG