MEGAResFrom MEG, the Microbial Ecology Group

VANI

The vanG gene encodes a D-ala-D-lac ligase. This gene is part of the VanI operon and is a core resistance gene.

References

Other Groups in VanI-type resistance protein

Sequences

Download Sequences

>CARD|phgb|HQ433580|0-512|ARO:3003723|VanI|Glycopeptides|VanI-type_resistance_protein|VANI
AAACGGCTGTATGAGGTCATGCCGGGCAAAGTATTCACCTCGTTGAGGATTACTGTTCCATCTTCTTTCAGAAACATATC
CACCCGCGCCAGTCCCCTGCAGCCCAAAGCGCGATAGATGGCTTTTGCCGTCTCCTGAACCCGCGAGCGCGCCTCTGGGG
AAATGTCGGCGGGAACGATTAGTGTTGAGTTTTCGGAACCCTTTTCCGGCTCATTCTCCTGATGGATTCTGAAAAAGCCA
TGAGACAGACAGATCTGATCGACCTCACCGGCCATCAAATCCAGATCGTTTCCAAATATCGCACAGCCTACCTCGCTGCC
GACGACAGCCTCTTCAATCAGCACCTTCGAGTCATACTGTCTGGCGATTTCCACCGCACTCAGCAATTCTTCTTGGCGGC
ATACCTTAGTGACGCCGAAGGATGAACCCGAACGGGCCGGCTTGACATAAACGGGATAAGCAAGCCGTTCAGCGTCAATA
GTCTCCTTCGCAGTGACCGTCCGGAACTTTGG