MEGAResFrom MEG, the Microbial Ecology Group

VANSI

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

Other Groups in VanI-type regulator

Sequences

Download Sequences

>CARD|phgb|NC_007907.1|4200836-4202015|ARO:3003726|vanSI|Glycopeptides|VanI-type_regulator|VANSI
TTAGCAATGCCGATCGGTTGCCTTTTCTTGTTTTTGCGGAAGCACGACAGTAAATACGGTCTTTTCTGAATTACTTTGCA
CGAAAATATTGCCTCCATGGGCGTTGGCTATTTCTTTGGCTATAGCCAATCCAAGTCCGGAACCGCCTGTATTGGTAGAG
CGGGATGTGTCCAGCCGAAAGAACTTCTCAAATATCGTTTCCAGTTTTTCTTGTGGGATCGGATTACCTTGATTCGTAAA
CGTTATAACAGTGTTTTTGTCCTGCTTTTGAGCAGAAATATCGATGACGCTGTTTTCATAGCTATAGGCCAGCGCATTTT
TCAAAATATTATTGAACACACGGGCCAGTTTGTCGGCATCCCCCCACAGTGTGAGACCTTCAGGGACATTGACGGACACC
TGCTTTCCCTGGGCAGGCGTCAGCATGGGATAGAATTCATCGGCCAACTGCTGGAGCATAAACAGTAAATTGATTTTTTC
TTTATTCAAGACAATCGTTTGCAGATTAAATCTTGTGATCTCAAAAAACTCATTGATCAGCTGCTCCAAGCGATACGCTT
TTTCCAAGGTAATACCGACATATTTTGCCTTCTGTTCCGGAGGCATATCGGGTGCTTCATCGAGAAGACTTAAGTATCCT
ATCACGGAGGTCAGGGGTGTCTTGATATCATGAGCCAAATAAACGACCAGATCATTTTTACGCTGCTCTGCTTCAAGAGC
AGCTTTCTTTTGTTTTTCCAAGTTGCTTTTTATCTGATTCAGCTTATTTTCCATAAAACCCAATTCCGCTGATAAGGCAA
TTTCGGCAGTAGACTCCCCAACAAGTTTATCCATTCCGTCACTGATTTCGTCAAAATATTTAGTAAACCAGGAGATTGAA
AAACCAAGCAAAATAACCAAGAATATAAGAATTACAATAAATGTAATAACTTCTATATTATGAAGAAATATATAACGATA
AATTATTACAGCATCGCTGTCACGCAGATAAAAGGTATTCTTTAAAAATTCTACAATACTGTCTCCAACACTAAAGTTCT
TTTGAATTACAGAACGCATGAGGATCACAGTTGCTGCCGTGGCAGAAACCAGCAGAAGCATTTGCAAAAATAATTTTCTT
TTTAATTTTGAATAATCATTTTTTCTTTTGCTTTTCTCACTTTTCAATTTTATAGCCAA