MEGAResFrom MEG, the Microbial Ecology Group

VANRI

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

Other Groups in VanI-type regulator

Sequences

Download Sequences

>CARD|phgb|NC_007907|4201992-4202691|ARO:3003728|VanRI|Glycopeptides|VanI-type_regulator|VANRI
TCACTTTTCAATTTTATAGCCAACCCCCCATACCGTTTTGATATATTTAGGATGTTCCGCGCTGTCTTGCATTTTTTCCC
TTAAATGCCGGATATGCACCATGACCGTATTATTGCTGTTGGTGAAATACTTGTCTCCCCATACCTCACTGAACAATTCT
TCCGAACTGACTACCCGGCCGCGGTTGGAGCAAAGGACCCAAAGAATGGAGAACTCCGTAGGCGTGAGGGATAGTTTTTT
TTCATTCAAGGTACATTCATGGGTATCCATGTCTAAGACCAAGCCGGAAAAGGCAATCACGTGTTCCTCTTGGTTTGGCT
CTGCAGAATTATACTTGGTAAATCTCCGCAGCTGCGCCTTGACGCGGGCAATCAGCTCCAAGGGACGGAACGGCTTGGTG
ATATAGTCGTCCGCGCCTAAGGTCAGCCCGGTAATCTTATCGATTTCTTCTTCCTTGGCTGTCAGCATGATCACCGGAAA
ATTATGCTTTTCCCGGATTTGCCGGCAGATTGAAAAACCGTCTACATCAGGGAGCATGACATCCAAAATGGCGAGATCCA
GTTTTTCCTTTTCAATACAGTCAAGGGCATCCTTGCCGTTATAAAATTTAAAGAGATTATAGTTCTCATTTTTCAGATAA
ACTTCCACCAAATCGGCAATAGCTTGTTCATCATCAACAATCAAAATATTAGCAGCCAA