Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

VANWI

The function of the vanW genes is currently unknown. This gene is part of the VanI operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Sequences

Download Sequences

>>MEG_7545|Drugs|Glycopeptides|VanI-type_accessory_protein|VANWI
ATGTTAAGAAGGAAACCATGGGTCTTTCTTTTGGTAATTTTATTTAGTCAGCTTAGCTTATCTATACTTTTGGGGGCTAC
GGTAACCTACGGTGCGGGTTATGCGAAGGCACCCGAGGGGTTGACGGTTTGGGAAAAAGATCTGGGTGGGATGACCAAGG
ATGAGGCCTATGCAGTCCTTGCCGAAGTAATCCCCAAGGCAGTCGTCTATGACCGGACGGTTTATTTCTTGGAGCTAAAC
CAAACCGATCAAGATCTAAAGGACTATCTGGCAAGTCAATACATCATTTCCACCGGAAATGTTATTACGGATGCCTTTGA
GTACCTGCACAGAATGTCAAGGACTATCCCGTCTCCTGAGTTACTCAATCAGGAGGAAGTTCTTGCTCAGCTCCGCAAGT
TCGCCCTGGATATCGATCAGCCGGGTAAGGCGGCTGAAGCCTATTATGAGAATGGCGAGATCGTCATCGAAGAGGGCAGT
TTGGGAGTCAGACTTGATGTGGACAAATCATGGGAACAACTGCAGCAAAGCATAGGCATGGAGACGGTGCCGCTTGTTAC
GGAGGTCATAGTGGTTCACCCTACTACGGCCGAATTAGAGAAGGTCAAAGATCCCTTGGGGGATTACACCACCTATTTTA
ACCCTTCCTTTCATGAACGGGTTACCAATGTACGGCTTGCGGCTGAAGCGATCAATGGACTTATTCTTCCGCCGGGTGGT
GAATTCTCCTTTAATGATACGGTGGGAAAACGTGAGCCTGAAAGAGGGTATTTGCCGGCTTTAATGTATATGGGCAATAG
AGTTGTCACAGATGATGGCGGAGGGATTTGCCAGGATTCGACCACTCTTTATCAAGCGACCAAACAGGCCAGGCTGGAAG
TGCTGGAAAGATACAGCCATTCTCTGCCGGTTTCCTATGTTCCGTTGGGGCAGGATGCTACGGTTGCTTATGGAGCGCTG
GATTTCCGCTTTCGGAACACGACTCAGGGTTATTTGCTGCTTAATGCAGCTACAGGCGGCAATTGGATTCGGGTAAGAAT
TTTCGGTGTGGCCGATTCTGAACACCCTGCCCTTGACGAACCGGACGGTTATCCTGTAAAACCCAGAGAATGGTCAAAGT
AA

>>MEG_7546|Drugs|Glycopeptides|VanI-type_accessory_protein|VANWI
ATGTTAAACGTTGACAAGATAAGTGAAGAAACCTATTATGCGTTCATTTCTCAAGCGGATCTAGGCAATTTTATGCAGTA
TCCTTCCTGGGCCAAGGTCAAAACTGAGTGGACCAGCGATTTATTGGGGTGGTTCACCCCGGACAATAAATTGGCAGGGT
GTGGTTTGATCTTATACCGGAAAATGCCCTGCCTTAACCGGTACCTGGCGTATTGTCCCCGCGGTCCCCTTATTGACTGG
CAGAGCCCCAACCTCAGGGAATGGTTCGAACCTCTTGTGGCTTATTTGAGAAGCAAGCAGGTTTTCAGTATCAAGATCGA
TCCTCCGGTGGTCCAGGCAAAATGGTCTGCCCCCACCATTAAAACGTTTTTAGGGCAAGCCCGTGAACAGGGCAGCAAAG
GGAAAGTTTTGCGCGATTTGCCGCCGGACGAAGACTACACAACGGTCCAACAAGTGCAGCAGCAATTACGGCAAATGGGT
TGGCGGAAGCAGCGGGGGGATACGGGTTTCGCTGCGACCCAGCCCCAATATGTTTACCGCCTGCCCTTAGAGGGGCGCAG
CCTGGAGGAGGTCTTCGCCGGTTTTCATACCAACTGGAGGCGCAATGTTAAAAAGGCCGAGCGTTTGGGCGTCAAGGTCC
GGGTCGGGACCGAACAGGATTTACCGGCTTTTTATGAGCTGCTGAAGGTAACTTCAGAACGGGATCACTTCAAGGTGCGC
AGTTTCTCCTACTTTTCCAATCTGTACCGGTCCTTAAAGGCTGAAGCGGCAGACCGTATTGCTCTTTATCTGGCGGAAGA
TGAAGAGGAATTATTGGCTGCTACCTTAGCCGTCCATTCCAACGCCCACTCATGGTATCTTTACGGGGCCAGCAGCAATG
TAAAACGGGAGAAGGCCCCGAATCATGCTATCCAGTGGCGGATGATTCAAGATGCTTATCAGCTTAAGGCCTACACCTAT
GATTTTAGAGGCATCAGCCCTACCCTGGATGAATCTGACCCCCTGTTTGGGTTGTTGAGATTTAAATTGGGCTTTGGAGG
CGAGGCTTGTGAAATGATCAGTGCTTGGGACTACCCCCTGCAGCCTTTATTATACCGGGCTTTCCAGCTGTACTTAAAAC
GGCGGTAG