MEGAResFrom MEG, the Microbial Ecology Group

VANWI

The function of the vanW genes is currently unknown. This gene is part of the VanI operon and is an accessory gene.

References

Other Groups in VanI-type accessory protein

Sequences

Download Sequences

>CARD|phgb|NC_007907.1|2195400-2196522|ARO:3003724|vanWI|Glycopeptides|VanI-type_accessory_protein|VANWI
TTACTTTGACCATTCTCTGGGTTTTACAGGATAACCGTCCGGTTCGTCAAGGGCAGGGTGTTCAGAATCGGCCACACCGA
AAATTCTTACCCGAATCCAATTGCCGCCTGTAGCTGCATTAAGCAGCAAATAACCCTGAGTCGTGTTCCGAAAGCGGAAA
TCCAGCGCTCCATAAGCAACCGTAGCATCCTGCCCCAACGGAACATAGGAAACCGGCAGAGAATGGCTGTATCTTTCCAG
CACTTCCAGCCTGGCCTGTTTGGTCGCTTGATAAAGAGTGGTCGAATCCTGGCAAATCCCTCCGCCATCATCTGTGACAA
CTCTATTGCCCATATACATTAAAGCCGGCAAATACCCTCTTTCAGGCTCACGTTTTCCCACCGTATCATTAAAGGAGAAT
TCACCACCCGGCGGAAGAATAAGTCCATTGATCGCTTCAGCCGCAAGCCGTACATTGGTAACCCGTTCATGAAAGGAAGG
GTTAAAATAGGTGGTGTAATCCCCCAAGGGATCTTTGACCTTCTCTAATTCGGCCGTAGTAGGGTGAACCACTATGACCT
CCGTAACAAGCGGCACCGTCTCCATGCCTATGCTTTGCTGCAGTTGTTCCCATGATTTGTCCACATCAAGTCTGACTCCC
AAACTGCCCTCTTCGATGACGATCTCGCCATTCTCATAATAGGCTTCAGCCGCCTTACCCGGCTGATCGATATCCAGGGC
GAACTTGCGGAGCTGAGCAAGAACTTCCTCCTGATTGAGTAACTCAGGAGACGGGATAGTCCTTGACATTCTGTGCAGGT
ACTCAAAGGCATCCGTAATAACATTTCCGGTGGAAATGATGTATTGACTTGCCAGATAGTCCTTTAGATCTTGATCGGTT
TGGTTTAGCTCCAAGAAATAAACCGTCCGGTCATAGACGACTGCCTTGGGGATTACTTCGGCAAGGACTGCATAGGCCTC
ATCCTTGGTCATCCCACCCAGATCTTTTTCCCAAACCGTCAACCCCTCGGGTGCCTTCGCATAACCCGCACCGTAGGTTA
CCGTAGCCCCCAAAAGTATAGATAAGCTAAGCTGACTAAATAAAATTACCAAAAGAAAGACCCATGGTTTCCTTCTTAAC
AT