MEGAResFrom MEG, the Microbial Ecology Group

VANKI

The vanK gene encodes a Fem family enzyme that cross-links pentapeptide cell wall precursors with amino acids. It is required for vancomycin resistance in the VanI cluster, however it is considered an accessory gene by normal classifications.

References

Other Groups in VanI-type accessory protein

Sequences

Download Sequences

>CARD|phgb|NC_007907|4204949-4206077|ARO:3003727|VanKI|Glycopeptides|VanI-type_accessory_protein|VANKI
CTACCGCCGTTTTAAGTACAGCTGGAAAGCCCGGTATAATAAAGGCTGCAGGGGGTAGTCCCAAGCACTGATCATTTCAC
AAGCCTCGCCTCCAAAGCCCAATTTAAATCTCAACAACCCAAACAGGGGGTCAGATTCATCCAGGGTAGGGCTGATGCCT
CTAAAATCATAGGTGTAGGCCTTAAGCTGATAAGCATCTTGAATCATCCGCCACTGGATAGCATGATTCGGGGCCTTCTC
CCGTTTTACATTGCTGCTGGCCCCGTAAAGATACCATGAGTGGGCGTTGGAATGGACGGCTAAGGTAGCAGCCAATAATT
CCTCTTCATCTTCCGCCAGATAAAGAGCAATACGGTCTGCCGCTTCAGCCTTTAAGGACCGGTACAGATTGGAAAAGTAG
GAGAAACTGCGCACCTTGAAGTGATCCCGTTCTGAAGTTACCTTCAGCAGCTCATAAAAAGCCGGTAAATCCTGTTCGGT
CCCGACCCGGACCTTGACGCCCAAACGCTCGGCCTTTTTAACATTGCGCCTCCAGTTGGTATGAAAACCGGCGAAGACCT
CCTCCAGGCTGCGCCCCTCTAAGGGCAGGCGGTAAACATATTGGGGCTGGGTCGCAGCGAAACCCGTATCCCCCCGCTGC
TTCCGCCAACCCATTTGCCGTAATTGCTGCTGCACTTGTTGGACCGTTGTGTAGTCTTCGTCCGGCGGCAAATCGCGCAA
AACTTTCCCTTTGCTGCCCTGTTCACGGGCTTGCCCTAAAAACGTTTTAATGGTGGGGGCAGACCATTTTGCCTGGACCA
CCGGAGGATCGATCTTGATACTGAAAACCTGCTTGCTTCTCAAATAAGCCACAAGAGGTTCGAACCATTCCCTGAGGTTG
GGGCTCTGCCAGTCAATAAGGGGACCGCGGGGACAATACGCCAGGTACCGGTTAAGGCAGGGCATTTTCCGGTATAAGAT
CAAACCACACCCTGCCAATTTATTGTCCGGGGTGAACCACCCCAATAAATCGCTGGTCCACTCAGTTTTGACCTTGGCCC
AGGAAGGATACTGCATAAAATTGCCTAGATCCGCTTGAGAAATGAACGCATAATAGGTTTCTTCACTTATCTTGTCAACG
TTTAACAT