MEGAResFrom MEG, the Microbial Ecology Group

VANXYG

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanG operon and is a core resistance gene.

References

Other Groups in VanG-type resistance protein

Sequences

Download Sequences

>CARD|phgb|DQ212986|7030-7795|ARO:3003069|vanXYG|Glycopeptides|VanG-type_resistance_protein|VANXYG
ATGATGAAAACGATTGAGCTTGAAAAGGAAGAAATTTATTGTGGAAATTTGCTGCTCGTCAACAAAAATTATCCGCTACG
AGATAACAATGTAAAGGGTTTAGTTCCTGCTGATATACGCTTTCCAAATATTCTTATGAAGCGTGATGTGGCAAATGTTT
TGCAGCTTATTTTTGAAAAAATCTCGGCAGGTAACTCTATCGTTCCTGTAAGCGGTTATCGCTCATTAGAAGAACAGACA
GCCATATATGACGGCTCTCTCAAAGATAATGGAGAGGATTTTACAAGAAAATATGTTGCTCTGCCCAATCATAGTGAACA
TCAAACAGGTCTTGCCATTGATTTAGGACTGAATAAAAAGGATATAGACTTTATCCGTCCCGATTTTCCCTATGACGGTA
TTTGCGATGAATTTAGGAGAGCTGCCCCAGACTATGGCTTTACCCAGCGTTATGCAAGGGATAAAGAAGAAATAACAGGG
ATTTCACACGAGCCGTGGCATTTTCGATATGTAGGATACCCACACTCAAAAATTATGCAGGAAAATGGTTTTTCACTTGA
AGAATACACACAATTTATAAAAGCCTATCTGGAAGATAACAAATATCTTTTTGAGCAGGCTCACAGAGCTGAGATTGAAA
TATATTATGTTCCTGCAAAAGACGACAAAACGCTGATAAAAATACCAGAAAATTGTGTTTATCAGATTTCTGGTAATAAC
ATAGACGGTTTTGTTGTGACCATATGGAGGAAAACAGATGACTAAA