MEGAResFrom MEG, the Microbial Ecology Group

VANTG

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanG operon and is a core resistance gene.

References

Other Groups in VanG-type resistance protein

Sequences

Download Sequences

>CARD|phgb|DQ212986|7787-9926|ARO:3002972|vanTG|Glycopeptides|VanG-type_resistance_protein|VANTG
ATGACTAAAAACGAAAGCTATTCTGGCATTGATTATTTTAGATTTATTGCAGCCTTATTGATTGTTGCTATTCATACTTC
GCCTCTCTCTTCTTTTAGTGAAACAGGCAACTTTATATTTACACGCATTGTAGCCCGTGTAGCCGTTCCGTTCTTTTTTA
TGACATCTGGATTTTTTCTGATTTCCAGATATACCTGTAATGCCGAAAAGCTGGGAGCTTTTATAAAAAAGACAACCTTA
ATTTACGGGGTTGCAATACTCTTATACATACCTATCAATGTTTATAACGGTTATTTCAAAATGGACAACCTTTTGCCAAA
TATCATAAAAGATATTGTATTTGATGGTACTTTATATCACTTGTGGTATCTTCCTGCATCTATTATCGGAGCTGCGATTG
CTTGGTATCTGGTAAAGAAAGTTCATTATCGCAAAGCCTTTTTGATAGCTTCTATACTCTATATCATAGGCTTATTTGGA
GATAGTTATTATGGAATTGTGAAAAGCGTTTCCTGCTTAAATGTTTTTTACAATCTAATCTTCCAATTAACAGATTACAC
AAGAAACGGAATATTTTTTGCCCCAATCTTTTTTGTGCTTGGTGGATATATCTCTGATAGTCAAAACAGACTATCGTTAA
AAAGAAGTATAGTAGGATTTATAGTTTGTTTTGCCCTTATGTTTGGAGAAGCCCTTACTTTACATCATTTTGATATACAG
AAACATGACAGTATGTATGTGCTTTTACTTCCGAGTGTGTATTGCTTATTTAATCTTCTTCTGCACTTTAGAGGAAAACG
CCGCACAGGATTACGGACAATATCATTGATTATCTATATCATTCATCCGTTTATGATTGTTGTAATACGATTGTTTGCCA
AATTACTGCATCTGCAAAGCCTGCTTGTTGAAAACAGCCTTGTTCATTATATTGCGGTCTGCTTTGCATCGGTAGTATTA
GCAGTGGTTATAACAGCGTTATTGAGCAGTCTGAAACCGAAAAAGGCAAAACATACCGCCGATACGGATAGAGCGTATCT
GGAAATCAACCTAAATAATTTAGAGCATAATGTAAACACTTTGCAAAAAGCAATGTCACCTAAATGTGAATTGATGGCGG
TTGTAAAAGCGGAAGCCTATGGTCACGGTATGTATGAAGTGACGACATATCTTGAGCAGATAGGAGTTTCTTCATTTGCG
GTAGCTACCATTGATGAAGGTATCCGATTGAGAAAATATGGCATCTCTAGCGAAATCCTAATTTTAGGCTATACATCGCC
TTCAAGGGCAAAAGAACTTTGTAAGTATGAGCTGACACAAACCTTGATAGATTATAGGTATTCGTTGCTTTTGAATAAAC
AGGGATATGACATTAAAGCACATATTAAAATTGACACAGGTATGCATAGACTTGGATTTAGCACAGAAGATAAGGATAAA
ATCCTTGCAGCTTTTTCTTTGAAGCACATCAAAGTTGCGGGAATTTTTACACATTTGTGTGCGGCTGACAGCCTTGAAGA
AAATGATGTTGCATTTACAAACAAGCAAATAGGCAGTTTCTATAAAGTGCTTGATTGGCTGAAAAGCAGCGGTTTGAATA
TACCTAAAGTACATATCCAAAGTAGTTATGGATTATTGAATTATCCAGAGCTTGAATGTGATTATATCAGAGTGGGTGTT
GCTCTGTATGGTGTTTTAAGCTCTACTAATGACAAAACAAAATTAGAACTTGATTTAAGACCTGTACTTTCTTTGAAAGC
AAAAGTTGTTTTAATTCGGAAGATAAAGCAGGGCGAAAGTGTTGGTTATAGCAGGGCTTTTACTGCAACCCGAGATAGTT
TAATTGCCATATTACCAATTGGATATGCAGATGGTTTTCCAAGAAATCTGTCTTGTGGAAATAGTTATGTGCTGATTGGT
GGACGACAAGCCCCTATTGTCGGAAAAATCTGTATGGATCAACTTGCAGTTGATGTAACAGATATTCCCAATGTTAAGAC
TGGAAGTATTGCAACGCTGATTGGTAAAGATGGAAAGGAAGAAATTACAGCACCGATGGTAGCTGAAAGTGCAGAAAGCA
TAACCAATGAATTGTTAAGCCGTATGGGACACAGATTAAATATTATTCGTAGAGCGTAAA