MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANG

The vanG gene encodes a D-ala-D-ser ligase. This gene is part of the VanG operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanG-type resistance protein

Sequences

Download Sequences

>>MEG_7392|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
atgaataataaaaaaattgcagttatatttggtggaaactcaacagaatatgatgtatcattacaatcagcttttgcagt
acttgagaatttgaatacggaaaaatatgatattctaccaattggaattacaagggagggtaattggtatcattatattg
gagattataataatatccagaataacacttggtttgaaagggatactgatataattccagttattgtttcgcagaaccgt
gtcaaaaatggtattattgaatttttaatttctgatgctgtttctcagaatcatattccaaatagtgctattgaatcatg
tgaaaatgatattaaatacactaaacttgattttgtatttcctgtattgcatggaaaaaatggagaagatggaacagtgc
aggggttatttgaattggcaggtatacaggttattggatgtggtactctttcttcagcattatgtatggacaaagacaaa
tcacataaacttgttcattcagaaggtattaaagtaccaaaatcaatattactaaaatactcagataaatttaatgtggc
tgaactgtcaaaagacttaacttatccattatttataaaacctgtgcgtgcaggttcatcatttggtattagtaaaattt
ataaaaaagaagagttacaagtagcagtagacttggcttttgaacatgataatgaagtaataattgaggaaaatattgat
ggttttgaggtagggtgtgcagttttaggaaacaatgacttacttgttggaagagtagatgaaatagaattgtcaaaagg
attttttgattatacagaaaaatatacattgaaaagttcaaaaattcatatgccagctagaattgatttggattgtgaga
aaagaatacaagagacagcaaaaattatttatagaactcttggatgttctggatttgctagagtagatatgtttttaact
ccatctggtgaaattatttttaatgaagtcaatacaattcctggctttacttctcatagtcgttatccaaatatgatgaa
aggtattggactgtcttttgaagaaatattggacaagataattgaggtgtacataaaatga

>>MEG_7393|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
atgattaagaaaagaatagcaatcatttttggaggaaattcaacggaatacgaggtgtccttgcagtcggcatctgccgt
ttttgagaatatcaacactaaaaagtttgacattgttcctattggaattaccagaaatggcgactggtatcattacacag
gcaaaaaagaaaagattgcaaataatacttggtttgaggataacgaaaacctgtattctgttgcggtatcgcaaaaccgt
tctgtaaaaggctttatagaatttaaggaagaaaaattctacatcatcaaggttgacttgatatttcctgtattgcacgg
caagaacggcgaggacggtactttgcagggattatttgaattagcaggaatacctgttgttgggtgtgatacactctcgt
ctgctctttgtatggacaaagataaggcacataaacttgttagccttgcgggtatctctgttccaaaatcagtaactttt
aaattctctggcaaaaaggcagccttgaaaaaaattgaaaaggagttaagctatccattatttgtgaagcctgtccgtgc
aggctcgtcatttggaataacaaaagtaactaaacagcaggaacttgaaaacgctatacaattagcgtttgaacacgatg
cggaagtcattgttgaagaaaccataaacggctttgaggttggttgtgcggtacttggtatagatgaactgattgtcggc
agagttgatgaaatcgaactgtcaagcggcttttttgattatacagagaaatatacacttaaatcttcaaagatatatat
gcctgcaaggattgatgccgaagcagaaaaacggatacaagaaacggctgtaaccatatataaagctctgggctgttcgg
gtttttccagagtggatatgttttatacaccgtctggcgaaattgtatttaatgaggtaaacacaataccaggctttacc
tcgcacagtcgctatccaaatatgatgaaaggcattggtctatcgttcgcccaaatgttggataagctgataggtctgta
tgtggaatga

>>MEG_7394|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
atgcaaaataaaaaaatagcagttatttttggaggcaattcaacagagtacgaggtgtcattgcaatcggcatccgctgt
ttttgaaaatatcaataccaataaatttgacataattccaataggaattacaagaagtggtgaatggtatcactatacgg
gagaaaaggagaaaatcctaaacaatacttggtttgaagatagcaaaaatctatgccctgttgtcgtttcccaaaatcgt
tccgttaaaggctttttagaaattgcttcagacaaataccgtattataaaagttgatttggtattccccgtattgcatgg
caaaaacggcgaaaatgggactttgcagggcatatttgaattggcaggaatacctgttgttggctgcgatacactctcat
cagctctttgtatggataaggacagggcacataaactcgttagccttgcgggtatatctgttcctaaatcggtaacattc
aaacgctttaacgaagaagcagcgatgaaagagattgaagcgaatttaacttatccgctgtttattaaacctgttcgtgc
aggctcttcctttggaataacaaaagtaattgaaaagcaagagcttgatgctgccatagagttggcatttgaacacgata
cagaagtcatcgttgaagaaacaataaacggctttgaagtcggttgtgccgtacttggcatagatgagctcattgttggc
agagttgatgaaatcgaactgtcaagcggcttttttgattatacagagaaatatacgcttaaatcttcaaagatatatat
gcctgcaaggattgatgccgaagcagaaaaacggatacaagaagcggctgtaaccatatataaagctctgggctgttcgg
gtttttccagagtggatatgttttatacaccgtctggcgaaattgtatttaatgaggtaaacacaataccaggctttacc
tcgcacagtcgctatccaaatatgatgaaaggcattggtctatcgttctcccaaatgttggataagctgataggtctgta
tgtggaatga

>>MEG_7395|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
ATGCAAAATAAAAAAATAGCAGTTATTTTTGGAGGCAATTCAACAGAGTACGAGGTGTCATTGCAATCGGCATCCGCTGT
TTTTGAAAATATCAATACCAATAAATTTGACATAATTCCAATAGGAATTACAAGAAGTGGTGAATGGTATCACTATACGG
GAGAAAAGGAGAAAATCCTAAACAATACTTGGTTTGAAGATAGCAAAAATCTATGCCCTGTTGTCGTTTCCCAAAATCGT
TCCGTTAAAGGCTTTTTAGAAATTGCTTCAGACAAATACCGTATTATAAAAGTTGATTTGGTATTCCCCGTATTGCATGG
CAAAAACGGCGAAGATGGTACTTTGCAGGGCATATTTGAATTGGCAGGAATACCTGTTGTTGGCTGCGATACACTCTCAT
CAGCTCTTTGTATGGATAAGGACAGGGCACATAAACTCGTTAGCCTTGCGGGTATATCTGTTCCTAAATCGGTAACATTC
AAACGCTTTAACGAAGAAGCAGCGATGAAAGAGATTGAAGCGAATTTAACTTATCCGCTGTTTATTAAACCTGTTCGTGC
AGGCTCTTCCTTTGGAATAACAAAAGTAATTGAAAAGCAAGAGCTTGATGCTGCCATAGAGTTGGCATTTGAACACGATA
CAGAAGTCATCGTTGAAGAAACAATAAACGGCTTTGAAGTCGGTTGTGCCGTACTTGGCATAGATGAGCTCATTGTTGGC
AGAGTTGATGAAATCGAACTGTCAAGCGGCTTTTTTGATTATACAGAGAAATATACGCTTAAATCTTCAAAGATATATAT
GCCTGCAAGGATTGATGCCGAAGCAGAAAAACGGATACAAGAAGCGGCTGTAACCATATATAAAGCTCTGGGCTGTTCGG
GTTTTTCCAGAGTGGATATGTTTTATACACCGTCTGGCGAAATTGTATTTAATGAGGTAAACACAATACCAGGCTTTACC
TCGCACAGTCGCTATCCAAATATGATGAAAGGCATTGGTCTATCGTTCTCCCAAATGTTGGATAAGCTGATAGGTCTGTA
TGTGGAATGA

>>MEG_7396|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
ATGATTAAGAAAAGAATAGCAATCATTTTTGGAGGAAATTCAACGGAATACGAGGTGTCCTTGCAGTCGGCATCTGCCGT
TTTTGAGAATATCAACACTAAAAAGTTTGACATTGTTCCTATTGGAATTACCAGAAATGGCGACTGGTATCATTACACAG
GCAAAAAAGAAAAGATTGCAAATAATACTTGGTTTGAGGATAACGAAAACCTGTATTCTGTTGCGGTATCGCAAAACCGT
TCTGTAAAAGGCTTTATAGAATTTAAGGAAGAAAAATTCTACATCATCAAGGTTGACTTGATATTTCCTGTATTGCACGG
CAAGAACGGCGAGGACGGTACTTTGCAGGGATTATTTGAATTAGCAGGAATACCTGTTGTTGGGTGTGATACACTCTCGT
CTGCTCTTTGTATGGACAAAGATAAGGCACATAAACTTGTTAGCCTTGCGGGTATCTCTGTTCCAAAATCAGTAACTTTT
AAATTCTCTGGCAAAAAGGCAGCCTTGAAAAAAATTGAAAAGGAGTTAAGCTATCCATTATTTGTGAAGCCTGTCCGTGC
AGGCTCGTCATTTGGAATAACAAAAGTAACTAAACAGCAGGAACTTGAAAACGCTATACAATTAGCGTTTGAACACGATG
CGGAAGTCATTGTTGAAGAAACCATAAACGGCTTTGAGGTTGGTTGTGCGGTACTTGGTATAGATGAACTGATTGTCGGC
AGAGTTGATGAAATCGAACTGTCAAGCGGCTTTTTTGATTATACAGAGAAATATACACTTAAATCTTCAAAGATATATAT
GCCTGCAAGGATTGATGCCGAAGCAGAAAAACGGATACAAGAAACGGCTGTAACCATATATAAAGCTCTGGGCTGTTCGG
GTTTTTCCAGAGTGGATATGTTTTATACACCGTCTGGCGAAATTGTATTTAATGAGGTAAACACAATACCAGGCTTTACC
TCGCACAGTCGCTATCCAAATATGATGAAAGGCATTGGTCTATCGTTCGCCCAAATGTTGGATAAGCTGATAGGTCTGTA
TGTGGAATGATGAAAACGATTGAGCTTGAAAAGGAAGAAATTTATTGTGGAAATTTGCTGCTCGTCAACAAAAATTATCC
GCTACGAGATAACAATGTAAAGGGTTTAGTTCCTGCTGATGTACGCTTTCCAAATATTCTTATGAAGCGTGATGTGGCAA
ATGTTTTGCAGCTTATTTTTGAAAAAATCTCGGCAGGTAACTCTATCGTTCCTGTAAGCGGTTATCGCTCATTAGAAGAA
CAGACAGCCATATATGACGGCTCTCTCAAAGATAATGGAGAGGATTTTACAAGAAAATATGTTGCCCTGCCAAATCATAG
CGAACATCAGACAGGACTTGCTATTGATTTGGGATTGAACGAAAAAGAAATAGATTTTATCCGTCCCGATTTCCCCTATG
TCGGTATCTGTAATGAGTTTAGAAAAGCAGCCCCAGACTATGGATTTATCGAACGCTATGCAAAGGACAAAGAAGAAATC
ACGGGAATTTCACACGAGCCGTGGCATTTTCGATATGTAGGATACCCACACTCAAAAATTATGCAGGAAAATGGTTTTTC
ACTTGAAGAATACACACAATTTATAAAAGCCTATCTGGAAGATAAAAAATATCTTTTTGAGCAGGCTCACAGAGCTGAGA
TTGAAATATATTATGTTCCTGCAAAAGACGACAAAACGCTGATAAAAATACCAGAAAATTGTGTTTATCAGATTTCTGGT
AATAACATAGACGGTTTTGTTGTGACCATATGGAGGAAAACAGATGACTAA

>>MEG_7397|Drugs|Glycopeptides|VanG-type_resistance_protein|VANG
ATGCAAAATAAAAAAATAGCAGTTATTTTTGGAGGCAATTCAACAGAGTACGAGGTGTCATTGCAATCGGCATCCGCTGT
TTTTGAAAATATCAATACCAATAAATTTGACATAATTCCAATAGGAATTACAAGAAGTGGTGAATGGTATCACTATACGG
GAGAAAAGGAGAAAATCCTAAACAATACTTGGTTTGAAGATAGCAAAAATCTATGCCCTGTTGTCGTTTCCCAAAATCGT
TCCGTTAAAGGCTTTTTAGAAATTGCTTCAGACAAATACCGTATTATAAAAGTTGATTTGGTATTCCCCGTATTGCATGG
CAAAAACGGCGAAGATGGTACTTTGCAGGGCATATTTGAATTGGCAGGAATACCTGTTGTTGGCTGCGATACACTCTCAT
CAGCTCTTTGTATGGATAAGGACAGGGCACATAAACTCGTTAGCCTTGCGGGTATATCTGTTCCTAAATCGGTAACATTC
AAACGCTTTAACGAAGAAGCAGCGATGAAAGAGATTGAAGCGAATTTAACTTATCCGCTGTTTATTAAACCTGTTCGTGC
AGGCTCTTCCTTTGGAATAACAAAAGTAATTGAAAAGCAAGAGCTTGATGCTGCCATAGAGTTGGCATTTGAACACGATA
CAGAAGTCATCGTTGAAGAAACAATAAACGGCTTTGAAGTCGGTTGTGCCGTACTTGGCATAGATGAGCTCATTGTTGGC
AGAGTTGATGAAATCGAACTGTCAAGCGGCTTTTTTGATTATACAGAGAAATATACGCTTAAATCTTCAAAGATATATAT
GCCTGCAAGGATTGATGCCGAAGCAGAAAAACGGATACAAGAAGCGGCTGTAACCATATATAAAGCTCTGGGCTGTTCGG
GTTTTTCCAGAGTGGATATGTTTTATACACCGTCTGGCGAAATTGTATTTAATGAGGTAAACACAATACCAGGCTTTACC
TCGCACAGTCGCTATCCAAATATGATGAAAGGCATTGGTCTATCGTTCTCCCAAATGTTGGATAAGCTGATAGGTCTGTA
TGTGGAATGATGAAAACGATTGAGCTTGAAAAGGAAGAAATTTATTGTGGAAATTTGCTGCTCGTCAACAAAAATTATCC
GCTACGAGATAACAATGTAAAGGGTTTAGTTCCTGCTGATATACGCTTTCCAAATATTCTTATGAAGCGTGATGTGGCAA
ATGTTTTGCAGCTTATTTTTGAAAAAATCTCGGCAGGTAACTCTATCGTTCCTGTAAGCGGTTATCGCTCATTAGAAGAA
CAGACAGCCATATATGACGGCTCTCTCAAAGATAATGGAGAGGATTTTACAAGAAAATATGTTGCTCTGCCCAATCATAG
TGAACATCAAACAGGTCTTGCCATTGATTTAGGACTGAATAAAAAGGATATAGACTTTATCCGTCCCGATTTTCCCTATG
ACGGTATTTGCGATGAATTTAGGAGAGCTGCCCCAGACTATGGCTTTACCCAGCGTTATGCAAGGGATAAAGAAGAAATA
ACAGGGATTTCACACGAGCCGTGGCATTTTCGATATGTAGGATACCCACACTCAAAAATTATGCAGGAAAATGGTTTTTC
ACTTGAAGAATACACACAATTTATAAAAGCCTATCTGGAAGATAACAAATATCTTTTTGAGCAGGCTCACAGAGCTGAGA
TTGAAATATATTATGTTCCTGCAAAAGACGACAAAACGCTGATAAAAATACCAGAAAATTGTGTTTATCAGATTTCTGGT
AATAACATAGACGGTTTTGTTGTGACCATATGGAGGAAAACAGATGACTAA