MEGAResFrom MEG, the Microbial Ecology Group

VANG

The vanG gene encodes a D-ala-D-ser ligase. This gene is part of the VanG operon and is a core resistance gene.

References

Other Groups in VanG-type resistance protein

Sequences

Download Sequences

>CARD|phgb|DQ212986|5984-7034|ARO:3002909|vanG|Glycopeptides|VanG-type_resistance_protein|VANG
ATGCAAAATAAAAAAATAGCAGTTATTTTTGGAGGCAATTCAACAGAGTACGAGGTGTCATTGCAATCGGCATCCGCTGT
TTTTGAAAATATCAATACCAATAAATTTGACATAATTCCAATAGGAATTACAAGAAGTGGTGAATGGTATCACTATACGG
GAGAAAAGGAGAAAATCCTAAACAATACTTGGTTTGAAGATAGCAAAAATCTATGCCCTGTTGTCGTTTCCCAAAATCGT
TCCGTTAAAGGCTTTTTAGAAATTGCTTCAGACAAATACCGTATTATAAAAGTTGATTTGGTATTCCCCGTATTGCATGG
CAAAAACGGCGAAGATGGTACTTTGCAGGGCATATTTGAATTGGCAGGAATACCTGTTGTTGGCTGCGATACACTCTCAT
CAGCTCTTTGTATGGATAAGGACAGGGCACATAAACTCGTTAGCCTTGCGGGTATATCTGTTCCTAAATCGGTAACATTC
AAACGCTTTAACGAAGAAGCAGCGATGAAAGAGATTGAAGCGAATTTAACTTATCCGCTGTTTATTAAACCTGTTCGTGC
AGGCTCTTCCTTTGGAATAACAAAAGTAATTGAAAAGCAAGAGCTTGATGCTGCCATAGAGTTGGCATTTGAACACGATA
CAGAAGTCATCGTTGAAGAAACAATAAACGGCTTTGAAGTCGGTTGTGCCGTACTTGGCATAGATGAGCTCATTGTTGGC
AGAGTTGATGAAATCGAACTGTCAAGCGGCTTTTTTGATTATACAGAGAAATATACGCTTAAATCTTCAAAGATATATAT
GCCTGCAAGGATTGATGCCGAAGCAGAAAAACGGATACAAGAAGCGGCTGTAACCATATATAAAGCTCTGGGCTGTTCGG
GTTTTTCCAGAGTGGATATGTTTTATACACCGTCTGGCGAAATTGTATTTAATGAGGTAAACACAATACCAGGCTTTACC
TCGCACAGTCGCTATCCAAATATGATGAAAGGCATTGGTCTATCGTTCTCCCAAATGTTGGATAAGCTGATAGGTCTGTA
TGTGGAATGAT