MEGAResFrom MEG, the Microbial Ecology Group

VANUG

The vanU gene encodes a putative regulator of the VanG operon. This gene is part of the VanG operon and is a regulator gene.

References

Other Groups in VanG-type regulator

Sequences

Download Sequences

>CARD|phgb|DQ212986|2029-2257|ARO:3000575|vanU|Glycopeptides|VanG-type_regulator|VANUG
ATGCGTGTTAGTTATAATAAGCTCTGGAAGCTTTTAATTGATAGGGACATGAAAAAAGGCGAGCTTCGTGAGGCTGTTGG
AGTAAGTAAAAGCACATTTGCGAAATTGGGCAAGAATGAGAATGTTTCTTTGACTGTTTTGTTAGCAATATGTGAGTATT
TGAATTGTGATTTTGGCGATATTATAGAAGCGTTGCCAGAAACCCCCGATAAGGAGCGTGACAGTTGAT