MEGAResFrom MEG, the Microbial Ecology Group

VANSG

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

Other Groups in VanG-type regulator

Sequences

Download Sequences

>CARD|phgb|DQ212986|2979-4086|ARO:3002937|vanSG|Glycopeptides|VanG-type_regulator|VANSG
ATGGACAGTGACTATACACAGCTCCAGACAAAAATATTAATAAGGACAGCGGTTGTGCTATTCGGGGCGTTTGCTCTGAT
TTCCGCATCTCTTAGTTTATTAAGCGGGCATTTTTCAAGGGCTGTTGTGGGGATTTTGGAAATATTCTATAAAGATTATG
AAAAGGCTTTGGTGGTATACACCTATGTGTTTCGGGACAATAAAGAATGGTTTGTGATGATAGCTGCATTTGTGTCGTTT
CTAATTGTATTACGATTGTATCTGAAAGGCTTCACAAAGTATTTTAATGAAATAAACAGAGGTATTAATGCCTTGAAAGA
GGAAAGTTCAGAAGATGTTGTATTATCTTCTGAGCTTGCGGCGACTGAAAAAACAATCAATACAATTAAGCATACCCTTG
AACAGCAGAAAACTGCGGCGCTGGTTGCAGAGCAAAGGAAGAACGACCTTGTAGTGTATCTTGCTCATGATTTAAAGACT
CCGCTTACATCTGTGATTGGATATTTGACATTGCTTAGGGACGAGAAGCAAATTTCAGATGAATTAAGGGAAAAGTATAT
ATGTATTTCACTGGAAAAAGCAGAACGATTGGAAAATCTGATCAATGAATTTTTTGAGATTACACGTTTTAATCTTTCCA
ACATAATACTTGAATATAGTGTGGTAAATTTAACTCGTATGTTGGAGCAGTTGGTTTTTGAATTCAATCCAATGCTTGCG
GAAAAAAAATTAAATTGTGTTCTTAAGACGATGCCGAATAAAATGATACGCTGCGACGCCAATAAAATGCAGAGGGTATT
CGATAATTTATTGAGAAATGCAGTGAATTATAGTTTTGAGAATACAGAGATTTCTATTACAGTCACACAAAATGAAAATA
TGGTTCATATTAAATTTGTAAATCATGGAAATACAATTCCAAAAGAGAAACTGGAACGTATTTTTGAACAGTTTTATCGT
CTGGATACTTCCAGAAGCACAGGGAATGGCGGCGCAGGCTTAGGGCTTGCTATTGCAAGGGAAATCGTAATGCTGCATGG
AGGGACAATAACCGCCCGCAGTGAAGATGAAAAGATTGAATTTGAAGTGACGATTCTTTCATCGTAGG