MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANRG

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanG-type regulator

Sequences

Download Sequences

>>MEG_7481|Drugs|Glycopeptides|VanG-type_regulator|VANRG
ATGAATGAAAAGATTTTAATTGTTGATGATGAAAAAGAGATAGCAGATTTAATTGAGCTTTATCTGAAAAATGACGGTTA
TAAAGTGTATAAATTTTACAATGGTATAGACGCATTAAAATGTGTGGAATCAGAAAAAATGGATTTGGCAATTTTAGATG
TTATGCTTCCTGATGTCGATGGTTTCCATATCTGTCAAAAGATTCGGGAACGATATTTTTATCCAATTATTATGCTGACG
GCAAAGGTAGAAGATGCTGATAAGATTATGGGGCTGACGATTGGAGCGGATGATTATATTACAAAGCCATTTAATCCACT
AGAGGTTGCTGCAAGGGTCAAGACACAGCTTCGCCGTTATGTATGTTACAATAATGCCGCAGATATAGAAAAAGAAAATG
TATTGGTTACGGAATATGATATTAACGGACTTGTCATTAATAAGAATACTCATAAATGCACACTGTATGGAAAGGCAGTC
ACATTAACCCCGATAGAATTTTCTGTTCTTTGGTATTTGTGTGAAAATAGGGGAAAAGTGATTTCTTCAGAGGAACTTTT
TGAAAATGTCTGGGGCGAGAAATTCCTTGATAATAATAATACAGTTATGGCTCATATCGGGAGGTTACGGGAAAAATTGA
AAGAACCTGCCAGAAATCCGAAATTTATAAAAACCGTATGGGGAGTGGGATATACCATTGAAGAATGA