MEGAResFrom MEG, the Microbial Ecology Group

VANRG

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanG operon and is a regulator gene.

References

Other Groups in VanG-type regulator

Sequences

Download Sequences

>CARD|phgb|DQ212986|2258-2966|ARO:3002926|vanRG|Glycopeptides|VanG-type_regulator|VANRG
ATGAATGAAAAGATTTTAATTGTTGATGATGAAAAAGAGATAGCAGATTTAATTGAGCTTTATCTGAAAAATGACGGTTA
TAAAGTGTATAAATTTTACAATGGTATAGACGCATTAAAATGTGTGGAATCAGAAAAAATGGATTTGGCAATTTTAGATG
TTATGCTTCCTGATGTCGATGGTTTCCATATCTGTCAAAAGATTCGGGAACGATATTTTTATCCAATTATTATGCTGACG
GCAAAGGTAGAAGATGCTGATAAGATTATGGGGCTGACGATTGGAGCGGATGATTATATTACAAAGCCATTTAATCCACT
AGAGGTTGCTGCAAGGGTCAAGACACAGCTTCGCCGTTATGTATGTTACAATAATGCCGCAGATATAGAAAAAGAAAATG
TATTGGTTACGGAATATGATATTAACGGACTTGTCATTAATAAGAATACTCATAAATGCACACTGTATGGAAAGGCAGTC
ACATTAACCCCGATAGAATTTTCTGTTCTTTGGTATTTGTGTGAAAATAGGGGAAAAGTGATTTCTTCAGAGGAACTTTT
TGAAAATGTCTGGGGCGAGAAATTCCTTGATAATAATAATACAGTTATGGCTCATATCGGGAGGTTACGGGAAAAATTGA
AAGAACCTGCCAGAAATCCGAAATTTATAAAAACCGTATGGGGAGTGGGATATACCATTGAAGAATGAA