MEGAResFrom MEG, the Microbial Ecology Group

VANYG

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanG operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanG-type accessory protein

Sequences

Download Sequences

>>MEG_7613|Drugs|Glycopeptides|VanG-type_accessory_protein|VANYG
atgaaccatatgaatatgaaacacagacgcagaaaacgcagacgtaaccaatcttttttgttcacaggaattttactctt
agttgtagtatctgcaagcgccaatttatggtacggttttggcaatgcggcaaaaaaagacagtgttattgaagaaatgc
catttaccattacacaggacggaatgcaggcaaaggaagaaataaagaaaacggtactggaaacttcctatggcggcaaa
cagcaggtagcggaagaaaatcacggcaatacacaaaatgcagggacagacgaagcgtggaatttaatgcttgtcaacag
agataatgcgattccagacaattacaaagtaaatctggcaagtaaaggcggggagcgtgtaaatcaccgtatctatgaac
ctcttatggaaatgcttaatgcggcaagggaagaaaactggggcgaattgccgatggtagtatctggctatcggacgcag
gaaaaacagcagagcctttatgatgaaaagattgcaaagttcaaaaaagaggggtattcagacagtgaagccgtaaggca
ggcagaacaatgggttgcagtgccaggtcacagtgagcatcagctcggttttgcagtggatattaacggggcaacttatg
atgtttatctatggttgcaggaaaacagctataaatacacggctttatcttcagatacccggcagaaaacggatattacc
gggactgctgaagaagtatggcattaccgttatgttggagtggaagcggcaactgaaatgtatgaaaatggattatgtct
tgaggaatatcttgagaaaaagcaatcagaaaactaa

>>MEG_7614|Drugs|Glycopeptides|VanG-type_accessory_protein|VANYG
ATGAACCATATGAATATGAAACACAGACGCAGAAAACGCAGACGTAACCAATCTTTTTTGTTCACAGGAATTTTACTCTT
AGTTGTAGTATCTGCAAGCAGTTTTTTATGGTACGGTTTTGGCAATGCGGCAAAAAAAGACAGTGTTATTGAAGAAATGC
CATTTACCATTACACAGGACGGAATGCAGGCAAAGGAAGAAATAAAGAAAACGGTACTGGAAACTTCCTATGGCGGCAAA
CAGCAGGTAGCGGAAGAAAATCACGGCAATACACAAAATGCAGGGACAGACGAAGCGTGGAATTTAATGCTTGTCAACAG
AGATAATGCGATTCCAGACAATTACGAAGTAAATCTGGTCGAAGTAGAGGGCGGGGAGCGTGTAGATGAGCGTATCTATG
AACCTCTTATGGAAATGCTTAATGCGGCAAGGGAGGAAAACTGGGGCGAATTGCCGATGGTAGTATCTGGCTATCGGACG
CAGGAAAAACAGCAGAGCCTTTATGATGAAAAGATTGCAAAGTTCAAAAAAGAGGGGTATTCAGACAGTGAAGCCGTAAG
GCAGGCAGAACAATGGGTTGCAGTGCCAGGTCACAGTGAGCATCAGCTCGGTTTTGCAGTGGATATTAACGGGGCAACTT
ATGATGTTTATCTATGGTTGCAGGAAAACAGCTATAAATACGGCTTTATCTTCAGATATCCCGGCAGTAAAACGGATATT
ACCGGGACTGCTGAAGAAGTATGGCATTACCGTTATGTTGGAGTGGAAGCGGCAACTGAAATGTATGAAAATGGATTATG
TCTTGAGGAATATCTTGAGAAAAAGCAATCAGAAAACTAA