Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANYG

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanG operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanG-type accessory protein

Sequences

Download Sequences

>>MEG_7613|Drugs|Glycopeptides|VanG-type_accessory_protein|VANYG
atgaaccatatgaatatgaaacacagacgcagaaaacgcagacgtaaccaatcttttttgttcacaggaattttactctt
agttgtagtatctgcaagcgccaatttatggtacggttttggcaatgcggcaaaaaaagacagtgttattgaagaaatgc
catttaccattacacaggacggaatgcaggcaaaggaagaaataaagaaaacggtactggaaacttcctatggcggcaaa
cagcaggtagcggaagaaaatcacggcaatacacaaaatgcagggacagacgaagcgtggaatttaatgcttgtcaacag
agataatgcgattccagacaattacaaagtaaatctggcaagtaaaggcggggagcgtgtaaatcaccgtatctatgaac
ctcttatggaaatgcttaatgcggcaagggaagaaaactggggcgaattgccgatggtagtatctggctatcggacgcag
gaaaaacagcagagcctttatgatgaaaagattgcaaagttcaaaaaagaggggtattcagacagtgaagccgtaaggca
ggcagaacaatgggttgcagtgccaggtcacagtgagcatcagctcggttttgcagtggatattaacggggcaacttatg
atgtttatctatggttgcaggaaaacagctataaatacacggctttatcttcagatacccggcagaaaacggatattacc
gggactgctgaagaagtatggcattaccgttatgttggagtggaagcggcaactgaaatgtatgaaaatggattatgtct
tgaggaatatcttgagaaaaagcaatcagaaaactaa

>>MEG_7614|Drugs|Glycopeptides|VanG-type_accessory_protein|VANYG
ATGAACCATATGAATATGAAACACAGACGCAGAAAACGCAGACGTAACCAATCTTTTTTGTTCACAGGAATTTTACTCTT
AGTTGTAGTATCTGCAAGCAGTTTTTTATGGTACGGTTTTGGCAATGCGGCAAAAAAAGACAGTGTTATTGAAGAAATGC
CATTTACCATTACACAGGACGGAATGCAGGCAAAGGAAGAAATAAAGAAAACGGTACTGGAAACTTCCTATGGCGGCAAA
CAGCAGGTAGCGGAAGAAAATCACGGCAATACACAAAATGCAGGGACAGACGAAGCGTGGAATTTAATGCTTGTCAACAG
AGATAATGCGATTCCAGACAATTACGAAGTAAATCTGGTCGAAGTAGAGGGCGGGGAGCGTGTAGATGAGCGTATCTATG
AACCTCTTATGGAAATGCTTAATGCGGCAAGGGAGGAAAACTGGGGCGAATTGCCGATGGTAGTATCTGGCTATCGGACG
CAGGAAAAACAGCAGAGCCTTTATGATGAAAAGATTGCAAAGTTCAAAAAAGAGGGGTATTCAGACAGTGAAGCCGTAAG
GCAGGCAGAACAATGGGTTGCAGTGCCAGGTCACAGTGAGCATCAGCTCGGTTTTGCAGTGGATATTAACGGGGCAACTT
ATGATGTTTATCTATGGTTGCAGGAAAACAGCTATAAATACGGCTTTATCTTCAGATATCCCGGCAGTAAAACGGATATT
ACCGGGACTGCTGAAGAAGTATGGCATTACCGTTATGTTGGAGTGGAAGCGGCAACTGAAATGTATGAAAATGGATTATG
TCTTGAGGAATATCTTGAGAAAAAGCAATCAGAAAACTAA