MEGAResFrom MEG, the Microbial Ecology Group

VANYG

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanG operon and is an accessory gene.

References

Other Groups in VanG-type accessory protein

Sequences

Download Sequences

>CARD|phgb|DQ212986|4222-5062|ARO:3002959|vanYG1|Glycopeptides|VanG-type_accessory_protein|VANYG
ATGAACCATATGAATATGAAACACAGACGCAGAAAACGCAGACGTAACCAATCTTTTTTGTTCACAGGAATTTTACTCTT
AGTTGTAGTATCTGCAAGCAGTTTTTTATGGTACGGTTTTGGCAATGCGGCAAAAAAAGACAGTGTTATTGAAGAAATGC
CATTTACCATTACACAGGACGGAATGCAGGCAAAGGAAGAAATAAAGAAAACGGTACTGGAAACTTCCTATGGCGGCAAA
CAGCAGGTAGCGGAAGAAAATCACGGCAATACACAAAATGCAGGGACAGACGAAGCGTGGAATTTAATGCTTGTCAACAG
AGATAATGCGATTCCAGACAATTACGAAGTAAATCTGGTCGAAGTAGAGGGCGGGGAGCGTGTAGATGAGCGTATCTATG
AACCTCTTATGGAAATGCTTAATGCGGCAAGGGAGGAAAACTGGGGCGAATTGCCGATGGTAGTATCTGGCTATCGGACG
CAGGAAAAACAGCAGAGCCTTTATGATGAAAAGATTGCAAAGTTCAAAAAAGAGGGGTATTCAGACAGTGAAGCCGTAAG
GCAGGCAGAACAATGGGTTGCAGTGCCAGGTCACAGTGAGCATCAGCTCGGTTTTGCAGTGGATATTAACGGGGCAACTT
ATGATGTTTATCTATGGTTGCAGGAAAACAGCTATAAATACGGCTTTATCTTCAGATATCCCGGCAGTAAAACGGATATT
ACCGGGACTGCTGAAGAAGTATGGCATTACCGTTATGTTGGAGTGGAAGCGGCAACTGAAATGTATGAAAATGGATTATG
TCTTGAGGAATATCTTGAGAAAAAGCAATCAGAAAACTAAT