MEGAResFrom MEG, the Microbial Ecology Group

VANWG

The function of the vanW genes is currently unknown. This gene is part of the VanG operon and is an accessory gene.

References

Other Groups in VanG-type accessory protein

Sequences

Download Sequences

>Gly|VanW-G_1_AY271782|Glycopeptides|VanG-type_accessory_protein|VANWG
GTGATTGAGGTGTATAAATTAACACAAAGAAAAAGACTAACGCAGTTGTTTCCTTTTTTGCTACCTCTCCGCAAATGGCA
AAGAAAAAAATATTTTTATTTCAAAATGAAATTTGACGGCAATAGATACGCAAAAAAGACATCTGAGAAATTGTTACCAA
ACACAGTATTTGAAACATCATCACTTATGCTAAATGAAAATAGTGGATTTGATATGAAGTACCAAATCAATAAGGTACAC
AACCTAAAACTTGCCGCAAAAACAATCAATAAAGTGATTATTGAGCCGAAAGAAACATTTTCATTTTGGCAGCTTGTACG
ATGGGCAGACCGTCACGAGAAATATAAGGACGGATTAAATCTTGTTAATGGAAAGATTGTAGGCTCTTATGGCGGAGGTT
TGTGTCAATTGAGTAATATGCTATTTTGGCTTTTTTTACACACGCCGCTTGTTATTGTCGAGCGACACGGACACGCAGTT
GAGTCTTTCCCATCAACAACCGAAGATTTGCCCTGCGGTACTGATGCTACGATTAACGAAGGTTGGTTAGACCTAAAACT
CCGTAACGACACGGACAATACTTTCCAGATTGAGATTAGTTTTGATGACAACTTTATGTATGGTCGAATTTTGTCGCAAA
GCTCCGTAAATATTGAATATACGGTTTTTAATTCGTCTGTTTCCTATTTCAAGCGAGAGGAAAAAGTATATCAAATAGCT
TCTGTTTGTCGTACAGAAAAAGACAAAATGACTGGTAGTCAGACGGAAAAAGAATTGTATGTCAACCAATGTAAAATAGC
CTATAAGCTACCCGATGATGTAAAAATTGAAGAAAGAGGTGTGTAA

>Gly|DQ212986.1|gene7|Glycopeptides|VanG-type_accessory_protein|VANWG
GTGATTGAGGTGTATAAATTAACACAAAGAAAAAGACTAACGCAGTTGTTTCCTTTTTTGCTACCTCTCCGCAAATGGCA
AAGAAAAAAATATTTTTATTTCAAAATGAAATTTGACGGCAATAGATACGCAAAAAAGACATCTGAGAAATTGTTACCAA
ACACAGTATTTGAAACATCATCACTTATGCTAAATGAAAATAGTGGATTTGATATGAAGTACCAAATCAATAAGGTACAC
AACCTAAAACTTGCCGCAAAAACAATCAATAAAGTGATTATTGAGCCGAAAGAAACATTTTCATTTTGGCAGCTTGTACG
ATGGGCAGACCGTCACGAGAAATATAAGGACGGATTAAATCTTGTTAATGGAAAGATTGTAGGCTCTTATGGCGGAGGTT
TGTGTCAATTGAGTAATATGCTATTTTGGCTTTTTTTACACACGCCGCTTGTTATTGTCGAGCGACACGGACACGCAGTT
GAGTCTTTCCCATCAACAACCGAAGATTTGCCCTGCGGTACTGATGCTACGATTAACGAAGGTTGGTTAGACCTAAAACT
CCGTAACGACACGGACAATACTTTCCAGATTGAGATTAGTTTTGATGACAACTTTATGTATGGTCGAATTTTGTCGCAAA
GCTCCGTAAATATTGAATATACGGTTTTTAATTCGTCTGTTTCCTATTTCAAGCGAGAGGAAAAAGTATATCAAATAGCT
TCTGTTTGTCGTACAGAAAAAGACAAAATGACTGGTAGTCAGACGGAAAAAGAATTGTATGTCAACCAATGTGAAATAGC
CTATAAGCTACCCGATGATGTAAAAATTGAAGAAAGAGGTGTGTAA

>CARD|phgb|AF253562|2978-3713|ARO:3000002|vanW|Glycopeptides|VanG-type_accessory_protein|VANWG
ATGAAATTTGACGGCAATAGATACGCAAAAAAGACATCTGAGAAATTGTTACCAAACACAGTATTTGAAACATCATCACT
TATGCTAAATGAAAATAGTGGATTTGATATGAAGTACCAAATCAATAAGGTACACAACCTAAAACTTGCCGCAAAAACAA
TCAATAAAGTGATTATTGAGCCGAAAGAAACATTTTCATTTTGGCAGCTTGTACGATGGGCAGACCGTCACGAGAAATAT
AAGGACGGATTAAATCTTGTTAATGGAAAGATTGTAGGCTCTTATGGCGGAGGTTTGTGTCAATTGAGTAATATGCTATT
TTGGCTTTTTTTACACACGCCGCTTGTTATTGTCGAGCGACACGGACACGCAGTTGAGTCTTTCCCATCAACAACCGAAG
AGATGCCCCGCCGGAACGAAGCTACGATTAACGAAGGTTGGTTAGACCTAAAACCCCGAAAAAAAACGAACATACTTTCC
AGATTGAGATTAGTTTTGATGACAACTTTAGTATGGTGCAATTTTGTCGCAAAGCTCGTAAATATTGATATACGGTTTTT
ATTCGTCTGTTTCCTATTTCAAGCGAGGGAAAAAGTATATCAAATAGCTTCTGTTTGTCGTACAGAAAAAGACAAAATGA
CTGGTAGTCAGACGGAAAAAGAATTGTATGTCAACCAATGTAAAATAGCCTATAAGCTACCCGATGGTGTAAAAATTGAA
GAAAGAGGTGTGTAA