MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANWG

The function of the vanW genes is currently unknown. This gene is part of the VanG operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanG-type accessory protein

Sequences

Download Sequences

>>MEG_7543|Drugs|Glycopeptides|VanG-type_accessory_protein|VANWG
GTGATTGAGGTGTATAAATTAACACAAAGAAAAAGACTAACGCAGTTGTTTCCTTTTTTGCTACCTCTCCGCAAATGGCA
AAGAAAAAAATATTTTTATTTCAAAATGAAATTTGACGGCAATAGATACGCAAAAAAGACATCTGAGAAATTGTTACCAA
ACACAGTATTTGAAACATCATCACTTATGCTAAATGAAAATAGTGGATTTGATATGAAGTACCAAATCAATAAGGTACAC
AACCTAAAACTTGCCGCAAAAACAATCAATAAAGTGATTATTGAGCCGAAAGAAACATTTTCATTTTGGCAGCTTGTACG
ATGGGCAGACCGTCACGAGAAATATAAGGACGGATTAAATCTTGTTAATGGAAAGATTGTAGGCTCTTATGGCGGAGGTT
TGTGTCAATTGAGTAATATGCTATTTTGGCTTTTTTTACACACGCCGCTTGTTATTGTCGAGCGACACGGACACGCAGTT
GAGTCTTTCCCATCAACAACCGAAGATTTGCCCTGCGGTACTGATGCTACGATTAACGAAGGTTGGTTAGACCTAAAACT
CCGTAACGACACGGACAATACTTTCCAGATTGAGATTAGTTTTGATGACAACTTTATGTATGGTCGAATTTTGTCGCAAA
GCTCCGTAAATATTGAATATACGGTTTTTAATTCGTCTGTTTCCTATTTCAAGCGAGAGGAAAAAGTATATCAAATAGCT
TCTGTTTGTCGTACAGAAAAAGACAAAATGACTGGTAGTCAGACGGAAAAAGAATTGTATGTCAACCAATGTGAAATAGC
CTATAAGCTACCCGATGATGTAAAAATTGAAGAAAGAGGTGTGTAA

>>MEG_7544|Drugs|Glycopeptides|VanG-type_accessory_protein|VANWG
GTGATTGAGGTGTATAAATTAACACAAAGAAAAAGACTAACGCAGTTGTTTCCTTTTTTGCTACCTCTCCGCAAATGGCA
AAGAAAAAAATATTTTTATTTCAAAATGAAATTTGACGGCAATAGATACGCAAAAAAGACATCTGAGAAATTGTTACCAA
ACACAGTATTTGAAACATCATCACTTATGCTAAATGAAAATAGTGGATTTGATATGAAGTACCAAATCAATAAGGTACAC
AACCTAAAACTTGCCGCAAAAACAATCAATAAAGTGATTATTGAGCCGAAAGAAACATTTTCATTTTGGCAGCTTGTACG
ATGGGCAGACCGTCACGAGAAATATAAGGACGGATTAAATCTTGTTAATGGAAAGATTGTAGGCTCTTATGGCGGAGGTT
TGTGTCAATTGAGTAATATGCTATTTTGGCTTTTTTTACACACGCCGCTTGTTATTGTCGAGCGACACGGACACGCAGTT
GAGTCTTTCCCATCAACAACCGAAGATTTGCCCTGCGGTACTGATGCTACGATTAACGAAGGTTGGTTAGACCTAAAACT
CCGTAACGACACGGACAATACTTTCCAGATTGAGATTAGTTTTGATGACAACTTTATGTATGGTCGAATTTTGTCGCAAA
GCTCCGTAAATATTGAATATACGGTTTTTAATTCGTCTGTTTCCTATTTCAAGCGAGAGGAAAAAGTATATCAAATAGCT
TCTGTTTGTCGTACAGAAAAAGACAAAATGACTGGTAGTCAGACGGAAAAAGAATTGTATGTCAACCAATGTAAAATAGC
CTATAAGCTACCCGATGATGTAAAAATTGAAGAAAGAGGTGTGTAA