MEGAResFrom MEG, the Microbial Ecology Group

VANSF

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanF operon and is a regulator gene.

References

Sequences

Download Sequences

>315|AF155139.2|AF155139|Glycopeptides|VanF-type_regulator|VANSF
ATGGGTAAAATACTACGAGGCTTTCGTTCAAAAATGATAATATTGTTAGGTTTAAGCATGTTGTTGTCTAGCGCCATAAC
ATACCTACTCTTTAAAGTACTCCAATTGTATTATTATACAAGTGTTGATTATGGAGATACACTAGCTTATTTTCGCAAAA
TCATACAAAATATTGGAGACTTTAACGTCTTTTTACTGTTATTTATCTTGCTTTCGATATTATTTTTCTTTTTACTTACA
AAACCCTATTCTGCCTATTTCAATGAAATTTCAAAAGGAATTCATTATCTCGCTCAGGGTGACTTTAAGCATCGAGTTCA
AATATTGTCAAATGATGAATTTAGTGATATTGCACAAAGCATTAATCTGGCAAGTGAAAAATTGGAACAAGCCATAGAAA
GGGGTGACTTTTCGGAAAGTAGTAAAGAGCAGTTAGTAGTAAATTTGGCTCATGATTTGCGCACACCTCTTACCTCTGTT
TTAGGTTATTTAGATTTAATCCTTAAGGATGATAACTTGACTGAAAATCAGATCAGACATTATTTAACGATTGCCTTTAC
CAAATCTCAACGCTTAGAAAGGTTAATTGATGAATTATTTGAAATAACTAGGATGAATTATGGCATGTTACCAATTAAAA
AGAAACAAATCGATTTAAGTGAGCTACTTATTCAATTGAAAGAAGAGTTGTATCCTGTCTTCGAGAAAAACGATTTGATA
GCAAGAATGAATATTACTTCCCCTTTATCTATTATGGGTGATGGAGAGTTATTGGCACGTGTGTTTGAAAATCTTCTGAT
TAATGCAAATCGCTATGGGTATGAGGGGCAGTATGTAGATATCAACGGTTTTATTGATTCAGAGGAAGTCGTTATTCAAG
TTATCAATTATGGGGATGCTATTCCTCCAGATGAACTGCCTCATATTTTTGATATGCTTTTTACTGGTGACAAAGCACGA
ACTCATCAAGAAAATAGTACAGGTCTCGGTTTATTCATTGCGGAGAATATTGTAGAGCAACACAATGGGACAATAACTGC
CGAAAGTGATTTAATACGCACGATATTTGAAGTCCGATTACCAATGGCGGATTCCTAA