MEGAResFrom MEG, the Microbial Ecology Group

VANZF

The function of the vanZ genes is currently unknown. This gene is part of the VanF operon and is an accessory gene.

References

Other Groups in VanF-type accessory protein

Sequences

Download Sequences

>317|AF155139.2|AF155139|Glycopeptides|VanF-type_accessory_protein|VANZF
ATGCTTACACCACTTACAGTTTTATATACTTATTTTTGTACTATTATTTTTTGTATTGTGTTTCAAATTGGATTTTTTTT
TAAAGCGCTAAAAAATATATCTATTAGGCATTTTCTATGGGTGTATGTTTTTCTGTTCTACCTTGCGCTAGTGTATATGA
TGACGGGGATAGGGAATGTATGGGTAGTAGGAAGATATGAAACATTGATTCGTGTAAGTGAAATCAACTTACTTCCATTT
TCTTCTGAAGGTGTTACTACGTATATTTTGAACATTATTCTGTTTATGCCGTTAGGTTTTTTATTGCCAACTATTTGGCC
GCAGTTTAGAACAATTAAAAATACTGCATGTACTGGATTCTTTTTTTCATTGGCTATTGAGCTAACTCAATTGCTAAATC
ATAGAATTACAGATATTGATGATTTACTTATGAACACCCTGGGGGCGATTATTGGGTATTTATTATATAGAGCTTTTAAA
ATGATATATACAAGAGATGAAAAAAAGCTTGATAATAAATCTTCTCTAGTAATAAAATACGAGGCTATTTTTTATATAGT
TTGCTCGTTTATAGGTATGATATTACTTTATTATCCATTTTTATTACGAAAAATTATTTGA