MEGAResFrom MEG, the Microbial Ecology Group

VANYF

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanF operon and is an accessory gene.

References

Other Groups in VanF-type accessory protein

Sequences

Download Sequences

>CARD|phgb|AF155139|3396-4278|ARO:3002958|vanYF|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGAAAAAGTGGGGACTTTTATTGGTTTTTGCATTATTTCTAGTATTTATTTTTAATATATTACCGATATCCCAAGATAA
AGTAGAGGATCGAATATATGAACAAAATGACAAAGATACATCGGATGATAAAATGACAGCTGAAAATATGCAAAAGATTG
AGCTTACGGAAGAGCAGATCTATCAAGGGAATCTACTCTTGGTCAACAATGAACATCCTGTTCACCAAAAGAGTATAAAA
TCGGATATTATAAATTTATTTACGCACAAAGAATTGACAAAGGGGTATGGGTTACTTGATAACGAAATTAAATTGTCAGA
GGAAATAGCTGGGAAATTTTCAGAGATGATAGCTGCGGCTGAAGAGGATGGCGTTAGTAATTTTTTAATTAGCAGTGGTT
ATCGAGACTTGGATGAGCAAAGCAGACTTTATGAGGAAATGGGTTCTGATTTTGCTTTGCCAGCAGGTCATAGTGAACAC
AACTTGGGGTTATCGCTTGATGTAGGATCTACTCAAATGAAGATGGATAAAGCGCCTGAAGGAAAGTGGATAGAAAAAAA
TTGTTGGGAATACGGCTTTATATTACGCTATCCCTTGGATAAAACGGATGTTACAGGAATTCAATATGAACCTTGGCATA
TTCGCTATGTCGGTTTGCCTCACAGTGCGATTATGCAGGAAATGAATTTAGCTTTGGAAGAATATTTAGATTATTTAAAA
GAAGAAAAGAGCATTTCTGTTCGTGTTGATGGGAAAAAATATACAATTTCATATGATCCCATTTCTCAAAACGAGACAAT
TGAAGTTGAAGTACCAGCGGATGAACAGTATGAAATATCTGGTAATAATATTGATGGAGTAATTGTGACCACATTTTCTT
GAA