MEGAResFrom MEG, the Microbial Ecology Group

VANYF

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanF operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Sequences

Download Sequences

>>MEG_7606|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGAAAAATATAACAATATTAATAGCTGATGATGATGCTGAAATTGCTGATTTGGTTGCTATACATTTAGAGAAAGAAGG
GTATCGTGTCATTAAGGTATCGGATGGGCAAGAAACCATTGATGTTATCCAGAACCAACCCATTGATTTACTGATTTTGG
ATATTATGATGCCGAAAATGGATGGATTTGAAGTGACACGTCGCATTCGCGAAAAACATAATATGCCCATTATTTTTTTG
AGCGCTAAAACGTCTGATTTTGATAAAGTGCAGGGACTCGTGATTGGAGCAGACGATTATATGACGAAACCATTTATACC
CATTGAATTGGTAGCTCGGGTAAATGCACAGCTGCGACGCTTTATGAAGTTGAATCAACCTAAAACCAAACAGAACTCAA
ACTTGGAATTTGGAGGATTAACGATTTCTCCTGAACAACGTACAGTTACTCTATATGGTAAGAATATTGAGTTAACACCG
AAAGAGTTTGAAATTTTATTTTTATTAGCCAGTAATCCAAATAAAGTTTATCGTGCAGAAGATATTTTTCAGAAGGTATG
GGGGGATGCATACTATGAAGGTGGGAATACCGTTATGGTTCATATTCGTACTTTGCGGAAAAAACTTGAAGAGGATAAAC
GAAAAAACAAATTGATACAAACTGTATGGGGGGTAGGTTATAAATTCAATGGGTAA

>>MEG_7607|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGGGTAAAATACTACGAGGCTTTCGTTCAAAAATGATAATATTGTTAGGTTTAAGCATGTTGTTGTCTAGCGCCATAAC
ATACCTACTCTTTAAAGTACTCCAATTGTATTATTATACAAGTGTTGATTATGGAGATACACTAGCTTATTTTCGCAAAA
TCATACAAAATATTGGAGACTTTAACGTCTTTTTACTGTTATTTATCTTGCTTTCGATATTATTTTTCTTTTTACTTACA
AAACCCTATTCTGCCTATTTCAATGAAATTTCAAAAGGAATTCATTATCTCGCTCAGGGTGACTTTAAGCATCGAGTTCA
AATATTGTCAAATGATGAATTTAGTGATATTGCACAAAGCATTAATCTGGCAAGTGAAAAATTGGAACAAGCCATAGAAA
GGGGTGACTTTTCGGAAAGTAGTAAAGAGCAGTTAGTAGTAAATTTGGCTCATGATTTGCGCACACCTCTTACCTCTGTT
TTAGGTTATTTAGATTTAATCCTTAAGGATGATAACTTGACTGAAAATCAGATCAGACATTATTTAACGATTGCCTTTAC
CAAATCTCAACGCTTAGAAAGGTTAATTGATGAATTATTTGAAATAACTAGGATGAATTATGGCATGTTACCAATTAAAA
AGAAACAAATCGATTTAAGTGAGCTACTTATTCAATTGAAAGAAGAGTTGTATCCTGTCTTCGAGAAAAACGATTTGATA
GCAAGAATGAATATTACTTCCCCTTTATCTATTATGGGTGATGGAGAGTTATTGGCACGTGTGTTTGAAAATCTTCTGAT
TAATGCAAATCGCTATGGGTATGAGGGGCAGTATGTAGATATCAACGGTTTTATTGATTCAGAGGAAGTCGTTATTCAAG
TTATCAATTATGGGGATGCTATTCCTCCAGATGAACTGCCTCATATTTTTGATATGCTTTTTACTGGTGACAAAGCACGA
ACTCATCAAGAAAATAGTACAGGTCTCGGTTTATTCATTGCGGAGAATATTGTAGAGCAACACAATGGGACAATAACTGC
CGAAAGTGATTTAATACGCACGATATTTGAAGTCCGATTACCAATGGCGGATTCCTAA

>>MEG_7608|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGAAAAAGTGGGGACTTTTATTGGTTTTTGCATTATTTCTAGTATTTATTTTTAATATATTACCGATATCCCAAGATAA
AGTAGAGGATCGAATATATGAACAAAATGACAAAGATACATCGGATGATAAAATGACAGCTGAAAATATGCAAAAGATTG
AGCTTACGGAAGAGCAGATCTATCAAGGGAATCTACTCTTGGTCAACAATGAACATCCTGTTCACCAAAAGAGTATAAAA
TCGGATATTATAAATTTATTTACGCACAAAGAATTGACAAAGGGGTATGGGTTACTTGATAACGAAATTAAATTGTCAGA
GGAAATAGCTGGGAAATTTTCAGAGATGATAGCTGCGGCTGAAGAGGATGGCGTTAGTAATTTTTTAATTAGCAGTGGTT
ATCGAGACTTGGATGAGCAAAGCAGACTTTATGAGGAAATGGGTTCTGATTTTGCTTTGCCAGCAGGTCATAGTGAACAC
AACTTGGGGTTATCGCTTGATGTAGGATCTACTCAAATGAAGATGGATAAAGCGCCTGAAGGAAAGTGGATAGAAAAAAA
TTGTTGGGAATACGGCTTTATATTACGCTATCCCTTGGATAAAACGGATGTTACAGGAATTCAATATGAACCTTGGCATA
TTCGCTATGTCGGTTTGCCTCACAGTGCGATTATGCAGGAAATGAATTTAGCTTTGGAAGAATATTTAGATTATTTAAAA
GAAGAAAAGAGCATTTCTGTTCGTGTTGATGGGAAAAAATATACAATTTCATATGATCCCATTTCTCAAAACGAGACAAT
TGAAGTTGAAGTACCAGCGGATGAACAGTATGAAATATCTGGTAATAATATTGATGGAGTAATTGTGACCACATTTTCTT
GA

>>MEG_7609|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGCTTACACCACTTACAGTTTTATATACTTATTTTTGTACTATTATTTTTTGTATTGTGTTTCAAATTGGATTTTTTTT
TAAAGCGCTAAAAAATATATCTATTAGGCATTTTCTATGGGTGTATGTTTTTCTGTTCTACCTTGCGCTAGTGTATATGA
TGACGGGGATAGGGAATGTATGGGTAGTAGGAAGATATGAAACATTGATTCGTGTAAGTGAAATCAACTTACTTCCATTT
TCTTCTGAAGGTGTTACTACGTATATTTTGAACATTATTCTGTTTATGCCGTTAGGTTTTTTATTGCCAACTATTTGGCC
GCAGTTTAGAACAATTAAAAATACTGCATGTACTGGATTCTTTTTTTCATTGGCTATTGAGCTAACTCAATTGCTAAATC
ATAGAATTACAGATATTGATGATTTACTTATGAACACCCTGGGGGCGATTATTGGGTATTTATTATATAGAGCTTTTAAA
ATGATATATACAAGAGATGAAAAAAAGCTTGATAATAAATCTTCTCTAGTAATAAAATACGAGGCTATTTTTTATATAGT
TTGCTCGTTTATAGGTATGATATTACTTTATTATCCATTTTTATTACGAAAAATTATTTGA

>>MEG_7610|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGAAAAATATCGGCATTACCATTTATGGATGTGAGAGGGACGAGGCTGAAGTGTTCAATGAACTTTCGCCACGCTTTGG
TGTCATACCTGCCATTACAAGCTCTGCCGTATCGGAAACCAACGCAATGTTAGCTCCCGGCAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCTCTGAAGGAATCCGGCGTCAAATATATCTCTACCCGAAGTATT
GGCTGCAATCACATAGACGTGAAGGCCGCGGAAAGTATGGGTATCGCTGTTGGAAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTGATGGCGATACGAAACGCAAAATCCATTGTGAGCCGTGCGGAAAAATATGATT
TCAGATTGGATACTGTCCCTGGAAAAGAATTGCGTGAGATGACGGTTGGCGTGCTGGGAACCGGTCAAATAGGCAAGGCG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAGCAAAGAGGCGGCGGCCAATTATGTATC
CCTCAATGAATTGCTGCAGAAAAGCGACATTCTCACCATTCATGTGCCGCTCGGCACGGACACATATCATATGATTGGTC
ACGAACAGATTGAAGCAGTGAAACAGGGCGCGTTTCTTATCAATACAGCGCGCGGCGGGCTTGTGGATACCGGCGCGCTG
ATCAAAGCGTTGGAAAATGGAAGGTTAGGCGGCGCGGCGTTGGATGTGTTGGAAGGAGAAGAAGGGCTTTTCTATTTTGA
TTGCACACAGAAACCGATTGACAACCAACTATTGCTTAAGCTCCACAAGATGCCAAATGTGATCATCACGCCGCATACGG
CGTACTATACCGGACGGGCACTGTATGATACCGTTGAAAAGACAATATTGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGAATAG

>>MEG_7611|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
TTGAATAGATTAAAAATAGCCATCCTGTTTGGGGGCTGTTCAGAGGAACACGATGTGTCGGTAAAATCGGCGAAAGAGAT
TGCCAATAACATTGACACGGAAAAATATGAGCCGATATACATCGGAATCACCCGATCCGGCGTCTGGAAAATGTGCGAAA
AGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAAAATGCACGGGCTGCTTGTT
ATGCGGAATAAAGGATATCAAATCCAACGTATAGACGCGGTATTTTCGGTTTTGCACGGCAAATCGGGTGAAGACGGCGC
CATACAAGGTTTATTTGAATTGTCCAGCATCCCCTATGTAGGCTGTGATGTTCAAAGTTCGGCGGTGTGTATGGACAAAT
CCCTGACATACATTGTGGCCCAAAATGCTGGTTTTGGCACTCCTGAATTTTTGATTTTGAATCATGGCGATATACCGGAT
TCAAATACCTTAACATATCCTGTTTTTGTTAAACCGGCGCGTTCCGGCTCATCTTTCGGCGTGAATAAAGTCAATAACGA
GGACGAATTAGACGCCGCCATTGAAACAGCAAGGCAGTATGACAGTAAAGTCCTGATTGAACAAGCTGTTCCAGGCCTTG
AAGTTGGCTGTGCCGTGTTGGGAAACGGTACCGACTTAATCGTTGGCGAAGTGGACCAAATTTCACTTTCGCATGGTATC
TTTCGTATTCATCAAGAAGATCAACCAGAAAAAGGCTCCGAAAACGCAGTTGTTTTGGTTCCCGCAAACCTGTCGGCAGA
GAAACGCATAAAGATACAAGAGACGGCGAAAGCAATTTATAAGGCGCTCGGCTGTAAAGGTCTTTCTCGTGTTGATATGT
TTTTGCAGGAAAACGGACGTATTATACTGAATGAAGTCAATACGTTGCCGGGATTCACGGCATACAGCCGTTATCCCCGT
ATGATGGCTGCCGCGGGGATGACACTGTCCGGGTTAATTGATCATTGCATCACACTGGCACTCAAAGGATGA

>>MEG_7612|Drugs|Glycopeptides|VanF-type_accessory_protein|VANYF
ATGGAAAAAGATTTTGTTTTTTTAGATGAAATATTGCATGGAGTTCGTTGGGACTCCAAATATGCCACATGGGACAATTT
CACTGGAAAACCGGTAGACGGATATGAAGTCAATCGCATAGCGGGGACATATGCTTTGGCTGTTGCGCTGCTGGAGGTAA
AGAAGCAGGCGGCTGCTCTAGGGTACGGCTTGCTCCTGTGGGATGGCTATCGTCCTCAACGTGCGGTAAACTGTTTCTTG
CATTGGTCTGCGCAGCCGGAAGACGGCCGCACAAAAGAAAGATATTATCCCAATATTGATCGGATCGAGATGGTTACAAA
GGGATATGTGGCTTCAAAATCAAGCCACAGTCGCGGAAGCGCGATTGACCTTACGCTTTATCGATTGGACACGGGTGCGC
TTGTCCCTATGGGGAGCGGCTTCGATTTTATGGATGAACGTTCACATCATACCTCAAAAGGAATTTCAAGTAACGAAGCG
CAAAATCGCCAGTTATTATGTTCTATTATGGAATACAGCGGATTTGAATCATATGTATATGAATGGTGGCACTACGTATT
AAGAAACGAACCATACCCCAGCAGCTATTTTGATTTTCCCATTGGCGGGAACCATCTAGACCCATTTTCCAACTTTTGTG
GGACAGTGCCACTTGATGCGTTGTCGCCCTAA