MEGAResFrom MEG, the Microbial Ecology Group

VANXYE

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanE operon and is a core resistance gene.

References

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>CARD|phgb|FJ872411|40765-41347|ARO:3002967|vanXYE|Glycopeptides|VanE-type_resistance_protein|VANXYE
ATGAAAAAAAATTATCTACGATTGATTAATGAAAACAATGAAATAAAAGACTCTGAGAGACCAAGTCACCTTGTTCAGGC
TCCGTTTGCACAAACAAATATACTAGTTGATCCTATGGTAGCGATACAGCTAGAAAAACTAATAAAGACAACAGGTCTTG
ATAGCCAAATTATTACCATTGATGGCTATCGTTCAAAGGAGACACAGCAAGCACTTTGGGATGAGACGATTCAAGAAAAA
GGGCTTGAATTTGCGCACAAATATGTGGCAAAGCCTGGATGTAGTGAACATGAAATTGGTTTAGCAGTGGATTTGGGGTT
AGCTACGAAAGAAAATGATTTTATTCGCCCAAGTTTCACTGATAGTCCGATTGTTGATAAATTTTTAAAGCATATGACAG
ATTTCGGCTTTATCTTAAGATATCAAAAAGGAAAAGAATCTATTACCAATATAAACTATGAACCATGGCATTTCAGGTAT
GTAGGGACACCCCATAGTTCGATTATGGTACAGCAAAACTGGGTATTAGAAGAATACATTGAATTCATTGAGTCAATAAG
AGGAACTGCTTATGAAGCATAGA