MEGAResFrom MEG, the Microbial Ecology Group

VANTE

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanE operon and is a core resistance gene.

References

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>CARD|phgb|FJ872411|41336-43445|ARO:3002971|vanTE|Glycopeptides|VanE-type_resistance_protein|VANTE
ATGAAGCATAGAGCTAACGGCATTGATCTATTTCGAATATTCGCTGCTACTATGGTTGTTGCTATCCATACATTCCCTTT
TCAATCAATAGCACCTTTTTTAGACGAAGTCATAACGTTAACTGTGTTTCGGGTAGCTGTCCCTTTTTTCTTTATGATTA
CAGGATATTTTTTGTTAGGAAGATTGTCATTAAATTTTTCGTATAATAATAATCAGAGAGTGAAAAAATATCTATACAAA
ATTGGAATGATTTATTTATATTCTATTTTATTGTATTTCCCATTATCTTTACTAAATGGCACTATTTCATTAAAAATGAA
CATACTTTTACTTTTAAAGGTTTTCATTTTTGACGGTACCTTTTATCACCTATGGTACTTTCCAGCTAGTATAATTGGAA
CGATTTTAGTAACCCTACTGTTACGTAGTATAGGATTTAAATTAACAGTCGCATTTTCTACATGTCTATATCTAGTTGGA
CTTGGTGGAGACAGCTGGTACGGGATAACCAATCAAGTTCCATTGCTAAATAAACTGTATACATTTATTTTTAGTTGGTC
GGACTATACGCGTTCAGGTGTTTTCTTTACGCCTGTGTTTCTTTGCCTAGGAATATTTGCCTATAGAGTATCTAAAAAGT
TAACTGCATCAAAGATATTAAACTTGCTTTTTTATGTGTTTATCATAGGTATGACTTTTGAGAGTATATTTCTACACCGA
TTTACGAACGTCAAACACGATAGTATGTATCTCTTATTGCCTTCATGTGCATTAATTTTGTTTTTAATGTTATTAAACTG
GCAACCAAAACTAAAGGTAAAAGAATCAGCCGATTTAACGTTACTGGTTTATATTCTCCATCCATTAGTTATTGTAATTG
TCCATTCTATAAGTAAGTATATTCCGATATTAAAAAACAGTTTGCTAAATTTCTTGTTAGTAGTCGTGTGCAGCTTTATA
CTAGCTCAGCTTCTGTTAAACTTAAAAAGAAAGCTAAGAGTTAGTAAGCAAAAAATACCATTTGAACGTGCTAGTAAAGA
AATATCAGCTAGTGCAATACACCATAATATTAATGAAATACGAAAGATAATTCCCAAAAATACAAATATTATGGGTGTTG
TGAAGGCAAATGCGTATGGCTGTGGCATGGTAGAGGTAGCTTATGAATTAGAAAAAATCGGTATTTCATTTTTCTGCGTA
GCTACTATAGAAGAAGCAATTGCTTTAAGGAAATCAGGAAACCAAGGGGATATTTTAATTTTAGGGTATACACATCCCAA
TCGCATTAATGATATAAAAAAATATAATTTGATTCAATCGATTGTAAGTGAAGAACATGGGAAAGTGTTGAATCTAAAAA
AAATACCTATTCGTTGTCATTTACAGGTTGATACTGGGATGCATCGTTTAGGTGTTACACCGAACGTAACAATTATTCAG
CAGATGTATCTTTTTTCCAATCTTAAGATTGAGGGGATATACTCACACTTAGGTTCTTCAGACTCATTAGAGCAAGAATC
AATCGCTCGAACAAATACTCAAATTTTTTTATTCAATAATATACTAAGTGATTTGGAACAAATGGGTATTTCCTACGGTT
ATACTCATATCCAAAGCAGCTATGGTATTTTAAATTACCCAGAATTAAGCTTTGATTTTGTGAGAATAGGAATTCTCTGT
TATGGATTTTTAAGTGACTATAATAGTCCGACTAAAATCCCTATAGATTTACAACCTATAGTAAAAGTAAAAGCCTCTTT
GATTACAGAAAGAATTGTGGAGGCAGGTGAATATGTTGGCTATGGATTAGGCGCTAAAGTTGAAAAAAGAACAAGAATAG
GTGTCGTTAGTATTGGGTATGCGGACGGTATACCAAGGGCATTATCCAATGCTAAACTTACGTTAGAGTTTAAAGGTCAA
TCAATAAAACAGATTGGGAATATTTGTATGGATATGATGCTTGTTGATCTGTCCGAAGTGGAAGATATTTCCTTGAATGA
TGAACTAATCGTGTTACCTAATATTAGTAAAATCGCTGATGAAGAACAAACAATTACCAATGAGCTATTGAGTCGATTAG
GTTCGAGGTTAGGTACAGAGTTAAATTGAT