MEGAResFrom MEG, the Microbial Ecology Group

VANHE

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanE operon and is a core resistance gene.

References

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>Gly|VanH-E|AF155139|4979-5947|969|Glycopeptides|VanE-type_resistance_protein|VANHE
ATGAAAAATATCGGCATTACCATTTATGGATGTGAGAGGGACGAGGCTGAAGTGTTCAATGAACTTTCGCCACGCTTTGG
TGTCATACCTGCCATTACAAGCTCTGCCGTATCGGAAACCAACGCAATGTTAGCTCCCGGCAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCTCTGAAGGAATCCGGCGTCAAATATATCTCTACCCGAAGTATT
GGCTGCAATCACATAGACGTGAAGGCCGCGGAAAGTATGGGTATCGCTGTTGGAAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTGATGGCGATACGAAACGCAAAATCCATTGTGAGCCGTGCGGAAAAATATGATT
TCAGATTGGATACTGTCCCTGGAAAAGAATTGCGTGAGATGACGGTTGGCGTGCTGGGAACCGGTCAAATAGGCAAGGCG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAGCAAAGAGGCGGCGGCCAATTATGTATC
CCTCAATGAATTGCTGCAGAAAAGCGACATTCTCACCATTCATGTGCCGCTCGGCACGGACACATATCATATGATTGGTC
ACGAACAGATTGAAGCAGTGAAACAGGGCGCGTTTCTTATCAATACAGCGCGCGGCGGGCTTGTGGATACCGGCGCGCTG
ATCAAAGCGTTGGAAAATGGAAGGTTAGGCGGCGCGGCGTTGGATGTGTTGGAAGGAGAAGAAGGGCTTTTCTATTTTGA
TTGCACACAGAAACCGATTGACAACCAACTATTGCTTAAGCTCCACAAGATGCCAAATGTGATCATCACGCCGCATACGG
CGTACTATACCGGACGGGCACTGTATGATACCGTTGAAAAGACAATATTGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGAATAG