MEGAResFrom MEG, the Microbial Ecology Group

VANE

The vanE gene encodes a D-ala-D-ser ligase. This gene is part of the VanE operon and is a core resistance gene.

References

Other Groups in VanE-type resistance protein

Sequences

Download Sequences

>Gly|VanE|FJ872411|39736-40794|1059|Glycopeptides|VanE-type_resistance_protein|VANE
ATGAAGACAGTTGCGATTATCTTTGGCGGAGTTTCTTCTGAATATGAAGTTTCACTGAAATCTGCTGTAGCGATTATTAA
AAATATGGAATCTATTGATTATAACGTAATGAAAATAGGGATCACCGAAGAAGGTCATTGGTATCTATTTGAAGGAACGA
CAGACAAAATAAAGAAAGATCGTTGGTTTTTAGATGAAAGCTGTGAAGAAATCGTAGTTGATTTCGCAAAAAAAAGCTTT
GTATTGAAAAACAGTAAAAAAATAATCAAGCCTGATATTTTATTCCCAGTTTTACATGGAGGTTATGGTGAGAATGGTGC
TATGCAGGGAGTATTTGAGTTATTAGATATTCCATATGTAGGTTGTGGTATCGGAGCTGCAGCAATCTCTATGAATAAAA
TAATGCTCCATCAATTTGCTGAAGCAATTGGTGTAAAAAGCACCCCTAGTATGATTATAGAAAAGGGACAAGACCTACAA
AAAGTCGATGCGTTTGCGAAAATACATGGATTTCCTTTATATATTAAACCGAATGAGGCAGGCTCATCAAAAGGAATTAG
CAAGGTAGAACGAAAAAGTGATTTATATAAAGCAATAGACGAAGCTTCAAAATATGATAGTCGTATTTTAATTCAAAAGG
AAGTGAAAGGGGTAGAAATTGGTTGTGGTATTTTAGGAAATGAACAATTGGTCGTTGGAGAATGTGACCAAATCAGTCTT
GTGGATGGCTTTTTCGATTATGAAGAGAAATACAATTTAGTAACAGCAGAAATTTTGTTACCAGCTAAACTATCAATAGA
CAAAAAAGAAGATATTCAGATGAAAGCAAAAAAACTATACAGACTATTAGGATGCAAAGGATTAGCGAGAATCGACTTTT
TCTTAACTGATGACGGAGAAATTTTATTAAATGAAATCAATACAATGCCTGGTTTTACAGAGCATTCGAGATTTCCAATG
ATGATGAATGAGATTGGGATGGACTACAAAGAGATTATAGAAAACCTATTAGTATTGGCGGTGGAAAATCATGAAAAAAA
ATTATCTACGATTGATTAA