MEGAResFrom MEG, the Microbial Ecology Group

VANSE

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanE operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanE-type regulator

Sequences

Download Sequences

>>MEG_7511|Drugs|Glycopeptides|VanE-type_regulator|VANSE
TTGAAAAATAATCTAACAGTGCAGATTACAAAAAAATATTTCTATACAATGATCATAATAACAACTATTCTAGTGATCCT
TCCTTTGGTAGCCAAAATGTTTCTTTCTCTTCGAGTATGGCAGGGTACTGAATTTTTTTACCCAATATTATATATTTTAA
ATAGATCATTAGGAGTCTGGTTGATTGTAACACCGTTATTTATTTGGTTGATAGTGACTTATATGTTCTTTAGAAAAATG
ATTAGCTATTTAGAGGAAATGATAGTGGCTACTAAGAGTTTAATTGAAACACCGAATGAAAAAATAGTGTTAAGAGTTGA
ATTAGCAGAGTTTGAGAATGAAATTAATCATATTCGTATAGATAGTTTAGAGAATAAAAAGATGGCCGAAGAAGCAGGAA
AAAAAAGAGATGATCTTCTAACCTATTTAGCACATGACTTGAGAACTCCTTTGACGAGTATTATTGGATATATCTCACTA
CTTCAAAATGAACAAACCTACTTGGAATTAGATTCTACAAAAAGGAAAAATTATATAGACATCATTTCAGACAAAGCTAA
CAGATTAGAGCATCTGCTCAATGATTTTTTTGAAATTGCAAAAACAGGCAAAAGTAGAGAAGAGGTGTATAAAGAAGAAG
TAGATTTAAGCTTGATGTTAAGCCAAATTAGTTCTGAATTTTTGCCTCTTTTAGACGAGAAGAAGCTTGAGTGGGATTTT
AAGATTGAACCAAATGTCTTTGTCCAATTAAATATTAATAAATTTGAACGAGTGTTGGATAATCTTATTAGAAATGCTAT
ATCATACTCGCTCAATGATACAACGATAAAACTTACATTAGAGAAAGTAGATGAGAAAGTAGTAGTATCTGTAGGAAATA
TAACTGATAAGGTATCAGAAAAGGACATAGACCAGCTATTTGAACCATTTTACAGAGGAGATAAATCGAGAAATACAAAA
ACAGGGAATGCTGGTCTAGGGTTAGCAATTGCCAAACAAATTATTAGTGAGCATGGTGGAACTATCGAGGCAGAACTACA
AAATAATGATTTCAAAGTATCAATTATTTTGTAA