MEGAResFrom MEG, the Microbial Ecology Group

VANRE

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanE operon and is a regulator gene.

References

Other Groups in VanE-type regulator

Sequences

Download Sequences

>CARD|phgb|FJ872411|43513-44203|ARO:3002924|vanRE|Glycopeptides|VanE-type_regulator|VANRE
ATGGCTAAAATACTAATTTTAGATGATGAAAAAGAGATTGTAAGTCTTCTAAGTACGCTACTTTCTAACGAAGGATATGA
GGTTTATGAGGCTATGTCAGGAAAAGAAAGCTTGGAGATTATAGAAAATAACAAGATCGATTTAGCCATACTAGATGTCA
TGCTTCCCGATATTTCCGGTTTTGATGTATTGCAAAGCATTAGAGAAAAACAATTTTTTCCTGTGTTGATGCTAACTGCT
CGAGGTCAGGATATGGATAAAATTACTGGACTGTCTATGGGGGCAGATGACTATATTGTTAAGCCGTTCAATCCTTTTGA
AGTGTTGGCTAGAGTGAAAACACAGCTACGTAGATATCAAACGTATAATTCTCAAAGTATAGATGAAACAAATGAATATG
CAAAAAATGGATTAAATATATCTGTCAACAGTCGAAAAGTATTCTTATATGATGAAGAAATTAAATTAACGCCTATTGAA
TTTGATATCTTGTGGTATTTGTGTAGAAATGAAGGTCGCGTAATATCGTCAGAAGAGTTATTTGAAAAAGTCTGGAAAGA
AGACTATCTAGAGAATAATAATACTGTTATGGCGCATATTGCTAAAATTAGAGAAAAGATGCATGAAAAGCCGAGACAGC
CAAATATTATAAAAACGGTATGGGGAGTAGGTTATACAATTGAAAAATAAT