MEGAResFrom MEG, the Microbial Ecology Group

VANHD

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanD operon and is a core resistance gene.

References

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>Gly|VanH-D_1_AB242319|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGATTCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA

>Gly|VanH-D|AY082011|4937-5908|972|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGAATCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA

>Gly|VanH-D_2_AF175293|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAGAAAATAATAGACATAACTGTTTTTGGCTGCGAGCCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGCGTTACGGCCACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTAATGGATGCCGGTGTGTAAGCG
TAAGCCATAAAGCGGAGCTATCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAATATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCTGGGTTACTGGGTATGGTTGTTGGTACAGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTGGGTGTGTTAGGAACTGGACGAATCGGACAG
GCAGTCATGGAACGTCTGGAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAGCGGACTATGT
TTCGTTTCATGAGCTGCTGAAAAAAAGTGACATTGTTACACTGCATATCCCGTTGGCGGAGGATACCCGCCATATGATTG
GCTATGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGGCGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGCGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTATCA
TGACTGCACCCAAAGAAGGATAGAACATCCTTTCCTGTCGGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCACACGGAACGGGTGTTGGTTGACACGGTCAGAAATACTATTAGAAATTGTTTGAACTTTGAAAGGAGTCTG
GGAAATGTTTAG

>Gly|VanH-D_4_AY489045|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAATAAAAAAATGGATATTACTGTTTTTGGATGTGAGTCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGTGTTACAGCTACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTGATGGATGCTGCTGCGTAAGCG
TAAGCCATAAAGCGGAGCTGTCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAGTATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCCGGGTTGCTGGGTATGGTTGTTGGCACGGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTCGGTGTGTTAGGAACTGGGCGAATCGGACAG
GCAGTCATGGAACGCCTGAAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAACGGACTATGT
TTCGTTTCATGAACTGCTGAAAAAAAGTGATATTGTTACACTGCATATTCCGTTGGCAGAAGATACCCGCCATATGATTG
GATGTGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGACGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGTGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTACCA
TGACTGCACTCAAAGAACGATAGAGCATCCTTTCCTGTCTGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA