MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANHD

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanD operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>>MEG_7419|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
atgaagaaaaagattgatattactgtttttggatgtgagccggacgaagcgacagttttccgtaaactgtcccatgaatt
tggtgttacggtctcactcgtaagagaagcagtatcggaggacaatgcaaaagtagccgatggatgccagtgtgtcagca
taagccataaagcggagctgtcggagcctctccttctcgcgttgaaagacgccggagtgaaatatatctgcacccggagc
atcggttataaccatattgatatacaggcggccggtcaaatgggaatgaccatcggcacagtagcctactcgccggggag
cgtcgccgactatgccattatgctgatgcttatgctgatgcgtggaacaaaatccgtaatacacagaactgaaaaacagg
attattgcctgaatagccttcgcgggaaggaattgcgggatatgacggttggcgtattaggggcgggacggatcggacag
gctgttatggaacgcttgaaaggattcggctgtacggtgctggcatatgaccgtaatcataaagccggagcagattatgt
ttcattttgtgagctgctgcaaagaagcgacatcattacgcttcatgttccgctggcagaagatactttccatatgattg
ggcgcgagcaattagaaatgatgaagaaagaggcgcttcttatcaatacggcgcggggcgctttagtggacaccggggca
ttggtagaggcactggcagatgggaaaattggaggcgccgctttagatgtactggaaggcgaagaagggtttttttatta
tgactgcacgtacaaggcggtagaacatccctttttatcgaccctacaaaggatgccaaatgtaattgttacgccgcata
ctgcctaccatacggaacgggtgttggttgacaccgtgagcaatacgattcggaattgtctgaactttgaaaggagtctt
ggaaatgtatag

>>MEG_7420|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
atggagaaaataatagacataactgtttttggctgcgagccagacgaaatggaggtttttcaaaagattacttatgagct
tggcgttacagccacactcataaaagattctatatcagaaagcaatgctaaattagcagatggatgccggtgtgtaagcg
taagccataaagcggagctatcagaaccgattcttcttgcactaaaaaatgcaggggtaaagtatatcagtacccggagc
attggctttaaccatattgatatacaggcggccgggttgctgggtatggttgttggcacagtagaatactcgccgggaag
tgtggccgattataccgtcatgctgatgcttatgctgatgcgcggcacaaagtcgattctgcgtgaaacccagaggcaga
attattgcctgaatgacctgcgcggaaaagaactgcgggatatgaccgtcggtgtgttaggaactgggcgaatcggacag
gcagtcatggaacgcctgaagggattcggctgtaaggtattggcgtatgaccgaaatcaaaaagcaggagcggactatgt
ttcgtttcatgaactgctgaaaaaaagtgacattgttacactgcatattccgttggcagaagatacccgccatatgattg
gatgtgaagagctggaaatgatgaagcaggaggcgcttctgatcaatacaggacggggcgctttagtggataccgcagca
ttggtagaagcattaaaaggacagaaaatcggcggcgccgcactggatgttttagagggcgaagaaggtatcttttacca
tgactgcactcaaagaacgatagaacatcctttcttgtctgtcctgcagggaatgccgaatgtcattgttacgccgcaca
cggcctatcacacggagcgggtgttggttgacacggttagaaataccattagaaattgtttgaattttgaaaggagtctg
ggaaatgtttaa

>>MEG_7421|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
atggagaaaataatagacataactgtttttggctgcgagccagacgaaatggaggtttttcaaaagatttcttatgagct
tggtgttacagccacactcataaaagattctatatcagaaagcaatgctggattagctaatggatgccggtgtgtaagcg
taagccataaagcggagctatcagaaccgattcttcttgcgctaaaaaatgcaggggtaaaatatatcagtacccggagc
attggttttaaccatattgatatacaggcggctgggttactgggtatggttgttggcacagtagaatactcgccgggaag
tgtggccgattataccgtcatgctgatgcttatgctgatgcgtggcacaaagtcgattctgcgtgaaacccagaggcaga
attattgcctgaatgacctgcgcggaaaagaactgcgggatatgaccgtgggtgtgttaggaactgggcgaatcggacag
gcagtcatggagcgcctggagggattcggttgtaaggtattggcgtatgaccgaaatcaaaaagcaggagcagactatgt
ttcgtttcatgaactgctgaaaaaaagtgacattgttacactgcatatcccgttggcggaggatacccgccatatgattg
gctatgaagagctggaaatgatgaaggaagaggcgcttctgatcaatacagggcggggcgctttagtggataccgcagca
ttggtagaagcattaaaaggacagaaaatcggcggcgccctggatgttttggaaggcgaagaaggtatcttttaccatga
ctgcacccaaagaagaatagaacatcctttcctgtcggtcctgcagggaatgccgaatgtcattgttacgccgcacacag
cctatcatacggaacgggtgttggttgacacggtcagaaatactattagaaattgtttgaattttgaaaggagtctggga
aatgtttag

>>MEG_7422|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAATGAAAAAATCTTAGTGGTTGACGATGAAAAAGAGTTGGCCGACTTAGTTGAAGTGTACCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAGGGACGCATTAAATTGCATTGAATCCGTGGAACTGGATTTAGCCATACTGGATA
TCATGCTCCCGGATATTGACGGTTTTCAAATCTGCCAGAAAATCCGGGAGAAGTTCTACTTCCCTGTTATCATGCTGACA
GCGAAAGTAGAAGATGGGGATAAAATCATGGGGCTGTCCGTTGCAGATGATTATATTACGAAGCCGTTTAATCCGCTGGA
AGTGGTTGCGAGGGTAAAGGCACAGCTAAGGCAGTACATGCGGTACAAGCAGCCCTGCATAAAGCAGGAGGCTGAACGCA
CGGAATACGATATCCGGGGGATGACAATCAGCAAGAGCAGCCATAAGTGTATCTTGTTTGGAAAGGAAATTCAACTGACA
CCAACGGAATTTTCGATCCTTTGGTATCTGTGCGAGCGTCAGGGAACGGTAGTTTCTACGGAGGAATTATTCGAGGCAGT
ATGGGGCGAGCGGTATTTTGACAGCAATAATACCGTGATGGCGCATATTGGGCGTCTCAGAGAGAAAATGAAGGAACCGT
CAAGAAACCCGAAGTTCATAAAAACCGTGTGGGGAGTTGGATATACCATTGAAAAATAA

>>MEG_7423|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGAATCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA

>>MEG_7424|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCTGATA
CAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAATCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGGAA
GCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGGGTTT
TTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGGATGA
AGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGATTTGT
TTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCCGGATTTACTTCCTATAGCCGTTATCCACGC
ATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAA

>>MEG_7425|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAAAAGAACTTTGTCTTTTTGGATGAAATGCTGCCGGGCATCCGGTGGGATGCCAAATATGCCACATGGGACAATTT
CACCGGGAAACCGGTAGACGGATACGAGGTAAACCGCATTGTGGGAACGAAAGAGCTTGGTGCCGCTTTACGTAAGGCAC
AGAAGGCGGCGGAGAAACTGGGATACGGTCTGCTCTTATGGGACGGCTACCGTCCCCAGTGTGCAGTGGACTGCTTTTTG
ACTTGGGCTTCCCTGCCGGAGAACAATCTGACGAAAAAGCGTTACTACCCAAATATCAAAAGGAACGAGATGATCACGAA
AGGGTATGTGGCTTCTCAGTCCAGCCACAGTCGCGGGAGCGCGATTGATCTCACGATTTTTCGTTTGGACACGGGTATGC
TTGTGCCAATGGGCGGAGATTTCGACTTTATGGATGTACGGTCGCATCATGCCGCCAGTGGTCTGAGCGAAGAGGAGGCC
GGAAACCGTGAGCGCCTGCGTGATATCATGGAGCGCAGCGGATTTGAAGCCTACCGATATGAATGGTGGCATTATGTCTT
GGCAGACGAGCCATACCCGGATACATATTTTGATTTTTGCATTGCCTAG

>>MEG_7426|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGATTCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA

>>MEG_7427|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAATAAAAAAATGGATATTACTGTTTTTGGATGTGAGTCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGTGTTACAGCTACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTGATGGATGCTGCTGCGTAAGCG
TAAGCCATAAAGCGGAGCTGTCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAGTATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCCGGGTTGCTGGGTATGGTTGTTGGCACGGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTCGGTGTGTTAGGAACTGGGCGAATCGGACAG
GCAGTCATGGAACGCCTGAAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAACGGACTATGT
TTCGTTTCATGAACTGCTGAAAAAAAGTGATATTGTTACACTGCATATTCCGTTGGCAGAAGATACCCGCCATATGATTG
GATGTGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGACGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGTGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTACCA
TGACTGCACTCAAAGAACGATAGAGCATCCTTTCCTGTCTGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAA

>>MEG_7428|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAGAAAATAATAGACATAACTGTTTTTGGCTGCGAGCCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGCGTTACGGCCACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTAATGGATGCCGGTGTGTAAGCG
TAAGCCATAAAGCGGAGCTATCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAATATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCTGGGTTACTGGGTATGGTTGTTGGTACAGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTGGGTGTGTTAGGAACTGGACGAATCGGACAG
GCAGTCATGGAACGTCTGGAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAGCGGACTATGT
TTCGTTTCATGAGCTGCTGAAAAAAAGTGACATTGTTACACTGCATATCCCGTTGGCGGAGGATACCCGCCATATGATTG
GCTATGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGGCGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGCGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTATCA
TGACTGCACCCAAAGAAGGATAGAACATCCTTTCCTGTCGGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCACACGGAACGGGTGTTGGTTGACACGGTCAGAAATACTATTAGAAATTGTTTGAACTTTGAAAGGAGTCTG
GGAAATGTTTAG

>>MEG_7429|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAAAAATATCGGCATTACCATTTATGGATGTGAGAGGGACGAGGCTGAAGTGTTCAATGAACTTTCGCCACGCTTTGG
TGTCATACCTGCCATTACAAGCTCTGCCGTATCGGAAACCAACGCAATGTTAGCTCCCGGCAATCAATGTATCAGCGTGG
GGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCTCTGAAGGAATCCGGCGTCAAATATATCTCTACCCGAAGTATT
GGCTGCAATCACATAGACGTGAAGGCCGCGGAAAGTATGGGTATCGCTGTTGGAAACGTGGCATATTCACCGGATAGCGT
TGCCGATTATACATTGATGCTGATGCTGATGGCGATACGAAACGCAAAATCCATTGTGAGCCGTGCGGAAAAATATGATT
TCAGATTGGATACTGTCCCTGGAAAAGAATTGCGTGAGATGACGGTTGGCGTGCTGGGAACCGGTCAAATAGGCAAGGCG
GTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAGCAAAGAGGCGGCGGCCAATTATGTATC
CCTCAATGAATTGCTGCAGAAAAGCGACATTCTCACCATTCATGTGCCGCTCGGCACGGACACATATCATATGATTGGTC
ACGAACAGATTGAAGCAGTGAAACAGGGCGCGTTTCTTATCAATACAGCGCGCGGCGGGCTTGTGGATACCGGCGCGCTG
ATCAAAGCGTTGGAAAATGGAAGGTTAGGCGGCGCGGCGTTGGATGTGTTGGAAGGAGAAGAAGGGCTTTTCTATTTTGA
TTGCACACAGAAACCGATTGACAACCAACTATTGCTTAAGCTCCACAAGATGCCAAATGTGATCATCACGCCGCATACGG
CGTACTATACCGGACGGGCACTGTATGATACCGTTGAAAAGACAATATTGAACTGTCTGGAATTTGAGAGGAGAGAGACA
CTTGAATAGATTAAAAATAGCCATCCTGTTTGGGGGCTGTTCAGAGGAACACGATGTGTCGGTAAAATCGGCGAAAGAGA
TTGCCAATAACATTGACACGGAAAAATATGAGCCGATATACATCGGAATCACCCGATCCGGCGTCTGGAAAATGTGCGAA
AAGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAAAATGCACGGGCTGCTTGT
TATGCGGAATAAAGGATATCAAATCCAACGTATAGACGCGGTATTTTCGGTTTTGCACGGCAAATCGGGTGAAGACGGCG
CCATACAAGGTTTATTTGAATTGTCCAGCATCCCCTATGTAGGCTGTGATGTTCAAAGTTCGGCGGTGTGTATGGACAAA
TCCCTGACATACATTGTGGCCCAAAATGCTGGTTTTGGCACTCCTGAATTTTTGATTTTGAATCATGGCGATATACCGGA
TTCAAATACCTTAACATATCCTGTTTTTGTTAAACCGGCGCGTTCCGGCTCATCTTTCGGCGTGAATAAAGTCAATAACG
AGGACGAATTAGACGCCGCCATTGAAACAGCAAGGCAGTATGACAGTAAAGTCCTGATTGAACAAGCTGTTCCAGGCCTT
GAAGTTGGCTGTGCCGTGTTGGGAAACGGTACCGACTTAATCGTTGGCGAAGTGGACCAAATTTCACTTTCGCATGGTAT
CTTTCGTATTCATCAAGAAGATCAACCAGAAAAAGGCTCCGAAAACGCAGTTGTTTTGGTTCCCGCAAACCTGTCGGCAG
AGAAACGCATAAAGATACAAGAGACGGCGAAAGCAATTTATAAGGCGCTCGGCTGTAAAGGTCTTTCTCGTGTTGATATG
TTTTTGCAGGAAAACGGACGTATTATACTGAATGAAGTCAATACGTTGCCGGGATTCACGGCATACAGCCGTTATCCCCG
TATGATGGCTGCCGCGGGGATGACACTGTCCGGGTTAATTGATCATTGCATCACACTGGCACTCAAAGGATGATACCCAT
GGAAAAAGATTTTGTTTTTTTAGATGAAATATTGCATGGAGTTCGTTGGGACTCCAAATATGCCACATGGGACAATTTCA
CTGGAAAACCGGTAGACGGATATGAAGTCAATCGCATAGCGGGGACATATGCTTTGGCTGTTGCGCTGCTGGAGGTAAAG
AAGCAGGCGGCTGCTCTAGGGTACGGCTTGCTCCTGTGGGATGGCTATCGTCCTCAACGTGCGGTAAACTGTTTCTTGCA
TTGGTCTGCGCAGCCGGAAGACGGCCGCACAAAAGAAAGATATTATCCCAATATTGATCGGATCGAGATGGTTACAAAGG
GATATGTGGCTTCAAAATCAAGCCACAGTCGCGGAAGCGCGATTGACCTTACGCTTTATCGATTGGACACGGGTGCGCTT
GTCCCTATGGGGAGCGGCTTCGATTTTATGGATGAACGTTCACATCATACCTCAAAAGGAATTTCAAGTAACGAAGCGCA
AAATCGCCAGTTATTATGTTCTATTATGGAATACAGCGGATTTGAATCATATGTATATGAATGGTGGCACTACGTATTAA
GAAACGAACCATACCCCAGCAGCTATTTTGATTTTCCCATTGGCGGGAACCATCTAGACCCATTTTCCAACTTTTGTGGG
ACAGTGCCACTTGATGCGTTGTCGCCCTAA

>>MEG_7430|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAAGAAAAAGATTGATATTACTGTTTTTGGATGTGAGCCGGACGAAGCGACAGTTTTCCGTAAACTGTCCCATGAATT
TGGTGTTACGGTCTCACTCGTAAGAGAAGCAGTATCGGAGGACAATGCAAAAGTAGCCGATGGATGCCAGTGTGTCAGCA
TAAGCCATAAAGCGGAGCTGTCGGAGCCTCTCCTTCTCGCGTTGAAAGACGCCGGAGTGAAATATATCTGCACCCGGAGC
ATCGGTTATAACCATATTGATATACAGGCGGCCGGTCAAATGGGAATGACCATCGGCACAGTAGCCTACTCGCCGGGGAG
CGTCGCCGACTATGCCATTATGCTGATGCTTATGCTGATGCGTGGAACAAAATCCGTAATACACAGAACTGAAAAACAGG
ATTATTGCCTGAATAGCCTTCGCGGGAAGGAATTGCGGGATATGACGGTTGGCGTATTAGGGGCGGGACGGATCGGACAG
GCTGTTATGGAACGCTTGAAAGGATTCGGCTGTACGGTGCTGGCATATGACCGTAATCATAAAGCCGGAGCAGATTATGT
TTCATTTTGTGAGCTGCTGCAAAGAAGCGACATCATTACGCTTCATGTTCCGCTGGCAGAAGATACTTTCCATATGATTG
GGCGCGAGCAATTAGAAATGATGAAGAAAGAGGCGCTTCTTATCAATACGGCGCGGGGCGCTTTAGTGGACACCGGGGCA
TTGGTAGAGGCACTGGCAGATGGGAAAATTGGAGGCGCCGCTTTAGATGTACTGGAAGGCGAAGAAGGGTTTTTTTATTA
TGACTGCACGTACAAGGCGGTAGAACATCCCTTTTTATCGACCCTACAAAGGATGCCAAATGTAATTGTTACGCCGCATA
CTGCCTACCATACGGAACGGGTGTTGGTTGACACCGTGAGCAATACGATTCGGAATTGTCTGAACTTTGAAAGGAGTCTT
GGAAATGTATAGGATTAACGTTGCGGTCCTGTTTGGGGGCTGCTCAGAAGAACATACTGTATCAATAAAGTCTGCAATGG
AGCTTGCGGCAAACATTGATACGGAAAAATATCAGCCTTTTTATATCGGGATCACAAAATCCGGTGTTTGGAAATTGTGT
GAAAAGCCCTGCCTGGATTGGGAACAATATGCAAAATATCCGGTCGTCTTTTCGCCGGGCAGAAATACGCATGGTTTTCT
GATACAAAAAGAGGATAGATATGAAATCCAACCTGTAGATGTAGTGTTCCCCATCATTCATGGAAAATTCGGAGAAGATG
GCTCAATACAGGGGCTGCTCGAATTATCGGGTATTCCCTATGTTGGCTGTGATATTCAAAGCTCCGTGATTTGCATGGAT
AAATCGCTTGCTTATACTACCGTAAAAAATGCAGGTATTGAAGTCCCTGATTTTCAGATTATCCAGGACGGTGACAGCCC
GAAAACCGAGTGCTTTAGCTTTCCTCTTTTTGTGAAACCTGCACGCTCTGGTTCTTCTTTTGGAGTAAATAAAGTAGATA
AAGCGGAGGATTTATGCGCTGCCATAAACGAAGCAAGGCAATATGACAGAAAAGTATTGATTGAGCAGGCCGTTTCTGGA
AGTGAGGTTGGCTGCGCCGTATTGGGAACCGGTACGGACCTAATTGTCGGAGAGGTCGATCAGATTAGCCTAAAACATGG
CTTTTTTAAGATTCATCAGGAAGCACAGCCTGAAAAGGGGTCTGAAAATGCAACGATCGAAGTGCCGGCTGATCTTCCGG
CAAAGGTAAGAGAGCGGATTCAGAAAACAGCTAAGAAGATTTATCAGGTGCTCGGCTGCAGAGGACTGGCCCGTATTGAT
TTGTTTTTGCGGGAGGACGGGCATATTGTCCTCAATGAAGTGAATACCATGCCCGGTTTTACTTCGTATAGCCGCTATCC
CTGTATGATGACTGCGGCAGGCTTTACCCTTTCGGAACTCATTGATCGTTTGATTGAACTGGCGCTCAGGAGGTAGACAT
GATGAAACAGAATTTTATTTTTTTAGACGAAGTGCTGCCTGGTATTCGTTGGGATGCCAAATATGCCACATGGGATAATT
TTACAGGCAAACCGGTGGACGGATATGAGGTAAACCGTATTGTAGGAACCAAAGAGCTGGGAGCTGCTTTACGCAAAGCT
CAAAAACTTGCCATGAAACAGGGATATGGGCTGCTCTTATGGGATGGTTATCGCCCTCAGCGTGCCGTGGATTGTTTTCT
GCATTGGGCGTCACTACCGGAGAATAATCTAACGAAAAACCGGTATTACCCTAATATAAAGCGGAATGAAATGGTGACAA
AGGGATATGTGGCCTCACAGTCCAGCCATAGCCGCGGAGGCGCAGTTGATCTCACGATTTTTTATTTAGATACCGGTATG
CTTGTTCCTATGGGCGGAGATTTTGATTTTATGGATGAACGGTCCCATCATGCTGCAAGCGGACTGACGGAGGAAGAATC
CAGAAACCGGGAATGTCTGCGCCATATCATGGGAAGGAGCGGCTTTGAAGCCTATTGTAACGAATGGTGGCATTATGTCC
TGGCAGATGAACCATACCCAAATACATATTTCAATTTTTGCATTGCATGA

>>MEG_7431|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGAATAAAAAAATGGATATTACTGTTTTTGGATGTGAGTCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGTGTTACAGCTACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTGATGGATGCTGCTGCGTAAGCG
TAAGCCATAAAGCGGAGCTGTCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAGTATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCCGGGTTGCTGGGTATGGTTGTTGGCACGGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTCGGTGTGTTAGGAACTGGGCGAATCGGACAG
GCAGTCATGGAACGCCTGAAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAACGGACTATGT
TTCGTTTCATGAACTGCTGAAAAAAAGTGATATTGTTACACTGCATATTCCGTTGGCAGAAGATACCCGCCATATGATTG
GATGTGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGACGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGTGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTACCA
TGACTGCACTCAAAGAACGATAGAGCATCCTTTCCTGTCTGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGG
AGGTTGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGC
GATAAGCCCTGCCGGGACTGGGAAAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGACCCATGGCCTGCT
GATACAAAAGGATGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACG
GAACCATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAACCTGTATGGAT
AAGTCGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCT
GAAAGCAGAGACACTCTCGTACCCGGTCTTTGTAAAACCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCC
GGGCAGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGCAAGTATGACTGCAAAATATTGGTTGAGGAGGCCGTTTCCGGG
AGTGAGGTAGGCTGTGCCATACTGGGAAATGAAAATGCTCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGG
TTTTTTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGTTCTGAAAATGCAGTTATCAGAGTTCCAGCTGTCTTACCGG
ATGAGGTAAGAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCCGAGGATTGGCTCGTATTGAT
CTGTTTTTGCGGGAGGACGGCTGCATTGTGCTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCC
CCGCATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAACTGC
CATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATT
TCACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCT
CAGAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCT
GAATTGGACTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAATGAGATGGTTGCGA
AGGGGTATGTGGCCTCAAAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGCGGTATG
CTTGTTCCTATGGGTGGAGATTTTGACTATATGGATGAACGGTCACACCATACCGCAAGCGGTCTGAGCGAAGAAGAATC
AAAAAACCGGCAGTGTTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCT
TGGTGGACGAGCCATACCCGGATACATATTTTGATTTTTGGATGGCCTAG

>>MEG_7432|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGAATCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGG
AGGTTGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGC
GATAAGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCT
GATACAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACG
GAACCATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAATCTGTATGGAT
AAGTCGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCT
GGAAGCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCC
GGGCAGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGG
AGTGAGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGG
GTTTTTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGG
ATGAAGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGAT
TTGTTTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCCGGATTTACTTCCTATAGCCGTTATCC
ACGCATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAACCAT
CATGGAAAAGAACTTTGTCTTTTTGGATGAAATGCTGCCGGGCATCCGGTGGGATGCCAAATATGCCACATGGGACAATT
TCACCGGGAAACCGGTAGACGGATACGAGGTAAACCGCATTGTGGGAACGAAAGAGCTTGGTGCCGCTTTACGTAAGGCA
CAGAAGGCGGCGGAGAAACTGGGATACGGTCTGCTCTTATGGGACGGCTACCGTCCCCAGTGTGCAGTGGACTGCTTTTT
GACTTGGGCTTCCCTGCCGGAGAACAATCTGACGAAAAAGCGTTACTACCCAAATATCAAAAGGAACGAGATGATCACGA
AAGGGTATGTGGCTTCTCAGTCCAGCCACAGTCGCGGGAGCGCGATTGATCTCACGATTTTTCGTTTGGACACGGGTATG
CTTGTGCCAATGGGCGGAGATTTCGACTTTATGGATGTACGGTCGCATCATGCCGCCAGTGGTCTGAGCGAAGAGGAGGC
CGGAAACCGTGAGCGCCTGCGTGATATCATGGAGCGCAGCGGATTTGAAGCCTACCGATATGAATGGTGGCATTATGTCT
TGGCAGACGAGCCATACCCGGATACATATTTTGATTTTTGCATTGCCTAG

>>MEG_7433|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGTCTTAGTAATGAAAGATATCGGCATTACCATTTATGGATCTGAGCAGGATGAGGCTGATGTGTTCCAGGAAATTTC
ATCTCGATTTGGCGTTACACCTACCATTGTAAGCTCTCCTATATCAGAAACCAACGTAATGTTAGCCCCTAAAAATAAGT
GTATCAGCGTGGGGCACAAGTCTGAGATTCACAAATCTATCCTTATTGCATTGAAGGAATCCGGCGTCAAATATATCTCT
ACTCGAAGTATTGGTTACAATCATATAGATATGAAGGCAGCGGAAAAAATGGGTATTGCTGTCGAGAACGTCACTTATTC
ACCAGATAGTGTTGCCGATTATACATTGATGCTGATACTTATGGCAATACGCCATACGAAATCTACTTTGTGCTCTATGG
AAAAACATGATTTCAGACTGAACAGCGTCCGTGGTAAAGTACTGCGTGACCTGACAGTAGGTGTACTGGGAACCGGTCAT
ATAGGCAAAGCGGTTATTGAGCGACTACAGGGGTTTGGAGGTCACGTGTTGGCGTACGGCAACAACAAAGAGGCGACGGC
AAATTATGTATCCTTCAATGAATTACTGCAAAAAAGTGACATTCTAACCATTCATGTACCCCTTAGCGATGACACATACC
ATATGATCGGTCACGAACAGATTAAAGCAATGAAACAGGGCGCCTTTCTTATTAATACTGCTCGAGGTGGACTTATAGAT
ACCGAAGTTCTGGTTAAAGCACTGGAGGACGGAAAACTGGGGGGCGCCGCATTAGATGTATTAGAGGGAGAAGAAGGGCT
TTTCTACTTTGATTGCACCCAAAAGCCAATTAACAATCAATTTTTGCTGAAACTTCAAAGGATGCCAAATGTGACAATCA
CACCGCATACGGCTTACTATAGCGAAAAAACGTTACGTGATACTGTTGAAAAAACAGTCAAGAACTGTTTGGAATTTGAG
AGGAGAGAGACACATGAATAGATTGAAAATAGCCATCCTGTTTGGGGGTTGCTCAGAAGAGCATAATGTATCGGTAAAAT
CAGCGGCAGAGATTGCCAACAACATTGATATAGGAAAATATGAACCAATATACATCGGAATAACCCAATCTGGCGTTTGG
AAAACATGCGAAAAACCATGTATAGATTGGGATAATGAACACTGTCGCTCGGCAGTACTTTCTCCGGATAAAAAAATGCA
TGGGTTGCTTATTATGCAAGATAAAGGATATCAAATACAGCGTATAGATGTAGTCTTTTCAGTGTTGCACGGAAAATCGG
GTGAAGACGGCGCCATACAAGGATTATTTGAATTGTCTGGTATACCTTATGTAGGCTGTGATATTCAAAGTTCGGCGGTT
TGTATGGACAAATCACTGGCATATATTATTGCGAAAAACGCTGGCATAGCTACTCCTGAATTTCAGGTCATTTATAAAGA
CGATAAGCCAGCGGCAGATTCGTTTACCTATCCCGTTTTTGTTAAGCCAGCACGTTCAGGTTCCTCCTATGGTGTGAATA
AAGTTAATAGTGCGGATGAATTGGACTCCGCAATTGACTTGGCAAGACAATATGACAGCAAAATCCTAATTGAGCAGGGT
GTTTTAGGTTATGAGGTCGGTTGTGCCGTATTGGGAAACAGTTTCGACTTGATTGTTGGTGAAGTGGATCAAATCAGACT
GCAACACGGTATTTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGTTCTGAAAACGCAACTATAACCGTTCCCGCAG
AACTATCGGCAGAGGAGCGAGAACGGATAAAAGAAGCGGCAAAAAATATATATAAGGCGCTCGGGTGTAGAGGTCTTTCT
CGTGTTGATATGTTTTTACAAGATAACGGCCGCATTGTACTAAATGAAGTCAATACCATGCCTGGTTTCACGTCATACAG
CCGTTATCCACGTATGATGGTCTCAGCAGGTATAACAATTCCCGAACTGATTGACCATCTGATTGTATTAGCTGTAAAGG
AGTGATAGGCATGGAAAAAGGATTTACCTTTTTAGATGAAATATTAAACGATGTTCGTTGGGACGCTAAATATGCTACGT
GGGACAACTTCACTGGAAAACCAATTGATGGATATGAAGTAAATCGAATTATAGGAACATATGAGTTAGCCGATGCGCTA
TTGAAGGTTCAAGAATTAGCTTTTAACCAAGGTTATGGATTGCTTTTATGGGACGGTTACCGTCCCCAACAAGCTGTAAA
TTGTTTTTTGCAATGGGCGGCACAGCCGGAAGATAATCGAACAAAGGCAAAATATTATCCCAATATTGACCGAACTGAGA
TGGTTTCAAAAGGATACGTGGCTTCAAAATCAAGTCATAGCCGCGGAAGTGCAATTGATCTTACACTTTATCGATTAGAC
ACGGACGAACTTGTTCCGATGGGGAGCGGATTTGATTTTATGGATGAGCGCTCTCATCATGAGGCAAAAGGAATTACGAG
CAATGAAGCGCAAAACCGTAGATTTTTGCGTTCCATTATGGAAAACAGTGGGTTTGAAGCGTATAGTTTCGAATGGTGGC
ACTATGTATTGATAAACGAACCTTATCCCTATAGCTGCTTTGATTTTCCTGTCAAATAA

>>MEG_7434|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGCAGGAAAAAATAGATATTACGGTTTTTGGGTGTGAGCGGGATGAAGCGGCGGTATTCCGTAAACTTTCATCTGAGTA
TGGCGTCACAGTTTCGCTCATCGAAGATGTCGTATCAGAGCACAATGCAAAATTAGCGGACGGATGCCAGTGTGTCAGCG
TAAGCCATAAGGCGGAGCTGTCGGAGCAGCTTCTCCTTGCGCTGAAACACGCAGGAGTGAAATACATCAGTACCCGGAGC
ATTGGATTCAACCATATTGATATACAGGCTGCAGGTCAGTTGGGTATGGCTGTTGGCACAGTGGCATACTCACCGGGAAG
CGTGGCCGATTATACCGTCATGCTGATGCTCATGCTGCTGCGCGGCACAAAGTCGGTTCTACGAGGAACCCAGAAGCAGA
ATTATTGTCTGAATGACTGCCGTGGAAAAGAACTGCAGGATTTGACGGTTGGCGTCCTGGGAACCGGACGAATCGGACAG
GCAGTCATGGAACGCCTGGAGGGATTCGGCTGCAAGGTGTTGGCCTATGACCGAACTCACAAAGCCGGAGCAAATTATGT
TTCGTTTTGTGAATTATTGAAGAGCAGCGACATTGTTACGCTGCATGTGCCTCTGGCAGAGGATACCCGCCATATGATTG
GGCGCGAGCAGCTAGAGATGATGAAGAGGGAGGCACTTCTGATCAACACGGCACGGGGGGCTTTAGTGGATACGGCTGCA
CTGGTTGCTGCGCTGAAAGAACAAAAAATCGGCGGAGCCGCCTTAGATGTCCTGGAAGGGGAAGAAGGCATCTTTTACCA
TGAATGCACACAAAAAACGATAGGGCATCCTTACCTCTCCGTTTTGCAGAAAATGCCCAATGTCATTGTTACGCCGCATA
CGGCCTATCATACGGATCGGGTACTGGTCGATACCGTGAGCAATACCATCCGAAATTGTCTGAATTTTGAAAGGAGTCTT
GGAAATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGG
AGGTTGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGC
GATAAGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCT
GATACAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACG
GAACCATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGTATGCGACATTCAAAGTTCTGTAATCTGTATGGAT
AAGTCGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCT
GGAAGCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCC
GGGCAGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGG
AGTGAGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGG
GTTTTTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGG
ATGAAGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGAT
TTGTTTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCTGGATTTACTTCCTATAGCCGTTATCC
ACGCATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAACCAT
CATGGAAAAGAACTTTGTCTTTTTGGATGAAATGCTGCCGGGCATCCGGTGGGATGCCAAATATGCCACATGGGACAATT
TCACCGGGAAACCGGTAGACGGATACGAGGTAAACCGCATTGTGGGAACGAAAGAGCTTGGTGCCGCTTTACGTAAGGCA
CAGAAGGCGGCGGAGAAACTGGGATACGGTCTGCTCTTATGGGACGGCTACCGTCCCCAGTGTGCAGTGGACTGCTTTTT
GACTTGGGCTTCCCTGCCGGAGAACAATCTGACGAAAAAGCGTTACTACCCAAATATCAAAAGGAACGAGATGATCACGA
AAGGGTATGTGGCTTCTCAGTCCAGCCACAGTCGCGGGAGCGCGATTGATCTCACGATTTTTCGTTTGGACACGGGTATG
CTTGTGCCAATGGGCGGAGATTTCGACTTTATGGATGTACGGTCGCATCATGCCGCCAGTGGTCTGAGCGAAGAGGAGGC
CGGAAACCGTGAGCGCCTGCGTGATATCATGGAGCGCAGCGGATTTGAAGCCTACCGATATGAATGGTGGCATTATGTCT
TGGCAGACGAGCCATACCCGGATACATATTTTGATTTTTGCATTGCCTAG

>>MEG_7435|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAGAAAATAATAGACATAACTGTTTTTGGCTGCGAGCCAGACGAAATGGAGGTTTTTCAAAAGATTACTTATGAGCT
TGGCGTTACAGCCACACTCATAAAAGATTCTATATCAGAAAGCAATGCTAAATTAGCAGATGGATGCCGGTGTGTAAGCG
TAAGCCATAAAGCGGAGCTATCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAGTATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCCGGGTTGCTGGGTATGGTTGTTGGCACAGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTCGGTGTGTTAGGAACTGGGCGAATCGGACAG
GCAGTCATGGAACGCCTGAAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAGCGGACTATGT
TTCGTTTCATGAACTGCTGAAAAAAAGTGACATTGTTACACTGCATATTCCGTTGGCAGAAGATACCCGCCATATGATTG
GATGTGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGACGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGCGCCGCACTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTACCA
TGACTGCACTCAAAGAACGATAGAACATCCTTTCTTGTCTGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CGGCCTATCACACGGAGCGGGTGTTGGTTGACACGGTTAGAAATACCATTAGAAATTGTTTGAATTTTGAAAGGAGTCTG
GGAAATGTTTAAGATTAAAGTTGCAGTTCTGTTTGGGGGCTGTTCAGAGGAACATAATGTTTCGATAAAATCTGCGATGG
AGATTGCCGCAAACATAGATACAAAAAAATATCAGCCTTATTATATTGGAATCACAAAATCCGGCGTTTGGAAGATGTGT
GAAAAACCTTGTTTGGGGTGGGAACAATATGCGGGGGATCCGGTTGTTTTTTCGCCGGACAGAAGTACGCATGGTCTGCT
GATACAAAAAGACACTGGGTATGAAATCCAGCCTGTAGATGTGGTATTTCCGATGATTCATGGCAAGTTTGGCGAAGATG
GATCCATACAAGGCTTGCTTGAATTGTCAGGCATTCCGTATGTGGGATGCGATATTCAAAGCTCCGTGATCTGCATGGAT
AAGGCGCTTGCATATACCGTTGTGAAAAATGCGGGTATCGCTGTGCCTGGGTTCCGGATCCTTCAGGAGGGGGATCGCCT
GGAAACGGAGGATTTAGTATATCCCGTCTTTGTAAAGCCTGCCCGTTCTGGCTCATCCTTTGGCGTAAACAAGGTATGCA
AGGCAGAAGAACTGCAGGCAGCAATCAGAGAAGCAAGAAAATATGATAGCAAGATTTTGATTGAAGAGGCCGTTACCGGG
AGTGAGGTAGGCTGCGCCATACTGGGAAACGAAAATGATCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGG
CTTTTTTAAGATTCATCAGGAAGCACAGCCGGAGAAGGGATCTGAAAATGCAGTTATCAGAGTTCCAGCCGCCTTACCGG
ATGAGGTAAGAGAACGGATTCGGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCCGAGGATTGGCCCGTATTGAT
CTGTTTTTGCGGGAGGACGGCTGCATTGTGCTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCC
CCGCATGATGACAGCAGCCGGTTTTACGCTTTCTGAAATACTGGATCGCTTGATTGAATTTTCACTTAGGAGGTAACTGT
TATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGGATCCGATGGGATGCCAAATATGCCACATGGGACAATT
TCACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGTTGGGAGTTGCTTTGCGTAAGGCT
CAGAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGAATTGTTTTCT
GAATTGGGCTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAACGAGATGGTCACCA
AAGGGTATGTGGCTTCCCAGTCCAGCCACAGCCGCGGAAGTGCAGTTGACCTTACGATTTTCCGTTTGGATACGGGGATG
CTTGTGCCAATGGGCGGAGATTTCGACTTCATGGATGTGCGGTCACATCATGCCGCAAGCGGTCTGAGCGAAGAGGAATC
AAAAAACCGGCAGTGCTTGCGTTATATCATGGAAAGCAGCGGATTTGAAGCCTATCGCTATGAATGGTGGCATTACGTCT
TGGCGGACGAGCCATACCCGGATACATACTTTGATTTTTGCATTGCCTAG

>>MEG_7436|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAGAAAATAATAGACATAACTGTTTTTGGCTGCGAGCCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGCGTTACGGCCACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTAATGGATGCCGGTGTGTAAGCG
TAAGCCATAAAGCGGAGCTATCAGAACCGATTCTTCTTGCACTAAAAAATGCAGGGGTAAAATATATCAGTACCCGGAGC
ATTGGCTTTAACCATATTGATATACAGGCGGCTGGGTTACTGGGTATGGTTGTTGGTACAGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGCGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTGGGTGTGTTAGGAACTGGACGAATCGGACAG
GCAGTCATGGAACGTCTGGAGGGATTCGGCTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAGCGGACTATGT
TTCGTTTCATGAGCTGCTGAAAAAAAGTGACATTGTTACACTGCATATCCCGTTGGCGGAGGATACCCGCCATATGATTG
GCTATGAAGAGCTGGAAATGATGAAGCAGGAGGCGCTTCTGATCAATACAGGGCGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGCGCCGCCCTGGATGTTTTAGAGGGCGAAGAAGGTATCTTTTATCA
TGACTGCACCCAAAGAAGGATAGAACATCCTTTCCTGTCGGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACA
CAGCCTATCACACGGAACGGGTGTTGGTTGACACGGTCAGAAATACTATTAGAAATTGTTTGAACTTTGAAAGGAGTCTG
GGAAATGTTTAGAATTAAAGTTGCAGTTCTGTTTGGGGGCTGTTCAGAGGAACATAATGTTTCGATAAAATCTGCGATGG
AGATTGCCGCAAACATAGATACAAAAAAGTATCAGCCTTATTATATTGGAATCACAAAATCCGGCGTTTGGAAAATGTGT
GAAAAACCTTGTTTGGAGTGGGAACAATATGCGGGGGATCCGGTTGTTTTTTCACCGGACAGAAGTACGCATGGTCTGCT
GATACAAAAAGACACTGGGTATGAAATCCAGCCTGTGGATGTGGGATTACCGATGATTCATGGCAAGTTTGGCGAGGATG
GCTCCATACAAGGCTTGCTTGAATTGTCAGGCATTCCGTATGTGGGATGCGATATTCAAAGCTCCGTGACCTGCATGGAT
AAGGCGCTTGCATATACCGTTGTGAAAAATGCGGGTATCGCTGTGCCTGGGTTCCGGATCCTTCAGGAGGGGGATCGCCT
GGAAACAGAGGATTTCGTATATCCCGTTTTTGTAAAGCCTGCCCGTTCCGGCTCATCCTTTGGCGTAAACAAGGTATGCA
AGGCAGAAGAACTGCAGGCAGCAATCGAAGATGCAAGAAAATATGACAGCAAGATTTTGATTGAAGAGGCCGTTACCGGG
AGTGAGGTAGGCTGCGCCATACTGGGAAACGGAAATGATCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGG
CTTTTTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGATCTGAAAATGCAGTCATCCGAGTTCCAGCCGCCTTACCGG
ATGAGGTAATAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCAGAGGATTGGCCCGCATTGAC
CTGTTTTTGCGGGAGGACGGCTGCATTGTGTTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCC
CCGCATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAACTGC
TATGAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGAATCCGATGGGATGCTAAATATGCCACATGGGACAATT
TCACCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCT
CACAAGATGGCGGAGAAACTGGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGGATTGTTTTCT
GAATTGGGCTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAACGAGATGATCACGA
AAGGGTATGTGGCTTCACAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGTGGTATG
CTTGTTCCTATGGGTGGGGATTTCGACTTTATGGATGAACGGTCACACCATGCCGCAAGCGGTCTGAGCGAAGAGGAATC
AAAAAACCGGCAGTGCTTGCGTTATATCATGGAGAGCAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCT
TGGCGGACGAGCCATACCCGGATACATATTTTGATTTTTGTATCGCCTGA

>>MEG_7437|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGGAGAAAATAATAGACATAACTGTTTTTGGCTGCGAGCCAGACGAAATGGAGGTTTTTCAAAAGATTTCTTATGAGCT
TGGTGTTACAGCCACACTCATAAAAGATTCTATATCAGAAAGCAATGCTGGATTAGCTAATGGATGCCGGTGTGTAAGCG
TAAGCCATAAAGCGGAGCTATCAGAACCGATTCTTCTTGCGCTAAAAAATGCAGGGGTAAAATATATCAGTACCCGGAGC
ATTGGTTTTAACCATATTGATATACAGGCGGCTGGGTTACTGGGTATGGTTGTTGGCACAGTAGAATACTCGCCGGGAAG
TGTGGCCGATTATACCGTCATGCTGATGCTTATGCTGATGCGTGGCACAAAGTCGATTCTGCGTGAAACCCAGAGGCAGA
ATTATTGCCTGAATGACCTGCGCGGAAAAGAACTGCGGGATATGACCGTGGGTGTGTTAGGAACTGGGCGAATCGGACAG
GCAGTCATGGAGCGCCTGGAGGGATTCGGTTGTAAGGTATTGGCGTATGACCGAAATCAAAAAGCAGGAGCAGACTATGT
TTCGTTTCATGAACTGCTGAAAAAAAGTGACATTGTTACACTGCATATCCCGTTGGCGGAGGATACCCGCCATATGATTG
GCTATGAAGAGCTGGAAATGATGAAGGAAGAGGCGCTTCTGATCAATACAGGGCGGGGCGCTTTAGTGGATACCGCAGCA
TTGGTAGAAGCATTAAAAGGACAGAAAATCGGCGGCGCCCTGGATGTTTTGGAAGGCGAAGAAGGTATCTTTTACCATGA
CTGCACCCAAAGAAGAATAGAACATCCTTTCCTGTCGGTCCTGCAGGGAATGCCGAATGTCATTGTTACGCCGCACACAG
CCTATCATACGGAACGGGTGTTGGTTGACACGGTCAGAAATACTATTAGAAATTGTTTGAATTTTGAAAGGAGTCTGGGA
AATGTTTAGAATTAAAGTTGCAGTTCTGTTTGGGGGCTGTTCAGAGGAACATAATGTTTCGATAAAATCTGCGATGGAGA
TTGCCGCAAACATAGATACAAAAAAATATCAGCCTTATTATATTGGAATCACAAAATCCGGCGTTTGGAAAATGTGTGAA
AAACCTTGTTTGGAGTGGGAACAATATGCGGGGGATCCGGTTGTTTTTTCGCCGGACAGAAGTACGCATGGTCTGCTGAT
ACAAAAAGACAAAGGGTATGAAATCCAGCCTGTGGATGTGGTGTTTCCGATGATTCATGGCAAGTTTGGGGAGGATGGCT
CCATACAAGGCTTGCTTGAATTGTCAGGCATTCCGTATGTGGGATGCGATATTCAAAGCTCCGTGATCTGCATGGATAAG
GCGCTTGCATATACCGTTGTGAAAAATGCGGGTATCACTGTGCCTGGGTTCCGGATCCTTCAGGAGGGGGATCGCCTGGA
AACGGAGGATTTCGTATATCCCGTTTTTGTAAAGCCTGCCCGTTCCGGCTCATCCTTTGGCGTAAACAAGGTATGCAAGG
CAGAAGAACTGCAGGCAGCAATCGAAGAAGCAAGAAAATATGACAGCAAGATTTTGATTGAAGAGGCCGTTACCGGGAGT
GAGGTAGGCTGCGCCATACTGGGAAACGGAAATGATCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGGCTT
TTTTAAGATTCATCAGGAAGCACAGCCGGAGAAGGGATCTGAAAATGCAGTCATCCGAGTTCCAGCCGCCTTACCGGATG
AGGTAAGAGAACAGATTCAGGAAACGGCAATGAAGATTTACCGGATACTTGGCTGCAGAGGATTGGCCCGCATTGACCTG
TTTTTGCGGGAGGACGGTTGCATTGTGCTGAATGAAGTGAATACCATGCCAGGTTTTACTTCCTACAGCCGCTATCCCCG
CATGATGACAGCAGCCGGTTTTACGCTTTCTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAACTGTCAT
GAAAAAGAACTTTGCCTTTTTAGATGAAATGATTCCCGGGATCCGATGGGATGCCAAATATGCCACCTGGGACAATTTCA
CCGGGAAACCGGTAGACGGATACATGGTAAACCGTGTTATGGGAACGAAGGAGCTGGGAGTTGCTTTGCGTAAGGCTCAG
AAGATGGCGGAGAAGCTAGGATATGGTTTGCTCTTATGGGACGGCTATCGCCCCCAGTGCGCAGTGAATTGTTTTCTGAA
TTGGGCTTCCCAACCGGAAGACAATCTGACGAAAAAGCGTTACTATCCAAATATCAAAAGGAATGAGATGGTTGCGAAGG
GGTATGTGGCCTCACAATCCAGCCACAGCCGTGGAAGTACGGTTGACCTTACAATTTTTCATTTGAATAGCGGTATGCTT
GTTCCTATGGGTGGAGATTTTGACTTTATGGATGAACGGTCACACCATGCCGCAAGCGGTCTGAGCGAAGAAGAATCAAA
AAACCGGCAGTGCTTGCGTTATATCATGGAGAGTAGCGGATTTGAAGCCTATCGTTATGAATGGTGGCATTACGTCTTGG
CGGACGAGCCATACCCGGATACATATTTTGATTTTTGCATTGCCTAG

>>MEG_7438|Drugs|Glycopeptides|VanD-type_resistance_protein|VANHD
ATGTCCTACAGAGACCTGGGTTTGATCGACAGCGAAGTGATCGCGGAGCGACGCGTCCGAGCGCTCGACGATTCGTCACC
CTCGGCCGTCCCGACCACTGGGGTCAGAGTTTTCGGATGCGGTCACGACGAAGCCGTTTTGTTCCGCGAGATGGGAACCC
GCCTCGGGATAACGCCAAGCATCACCGAGGAAGCGATCAGTGAAACCAACGCTGAACTGGCGCGTGGCAACCGATGCATC
AGCGTGAGCCACAAGACGCAGATCGACAATTCCACGCTGCTGGCGCTGAGCCGAGTCGGAGTGGAGTACATCTCCACCAG
AAGCGTCGGGTACAACCACATCGACGTGGAATTCGCGGCGAGCATCGGCATCTCGGTCGGCAACGTCGACTACTCGCCCG
ACAGCGTGGGCGACTACACACTGATGTTGATGCTGATGACCGTACGCCACGCGAAATCAATTGTCCGCCGCGCCGATACG
CATGATTACCGGCTGAATGACACGCGCGGCAGGGAGCTGCGCGACTTGACCGTCGGGGTGATCGGAACAGGGCGCATCGG
CACAGCAGTCATCGACCGGCTGCAGGGATTTGGCTGCCGCGTGCTGGCACATGACAGCGGGCCTCACGCCTCCGCCGACT
ACGTTCCGCTCGATGAACTGCTGCGGCAGAGCGACATTGTCACGCTCCACACTCCACTCACCGCGGACACACACCATCTC
CTCGATCGCCAACGCATCGACCAGATGAAGCACGGCGCGTACATCGTCAACACGGGTCGCGGACCGCTGCTCGATACCGA
GGCCCTCCTCTCCGCATTGGAGAGCGGCCGGTTGGGCGGCGCGGCGCTCGATGTCGTCGAAGGAGAGGAAGGGATCTTCT
ACGCCGACTGCAGGAACAGGCTCATCGAGAACAAGGCCCTGGTGCGGCTACAGCGCCTGCCGAATGTGCTGATCAGTCCG
CACTCCGCCTACTACACAGACCACGCCCTGAACGACACCGTCGAAAACAGCCTCGTCAACTGCCTGAACTTTGAAAGTGG
GAGAACAGCATGAGCAGATTGAAGGTCGGGGTCATCTTCGGAGGGGCTTCCGAAGAACATCCCGTCTCCATCAAGTCGGC
GCGAGAGGTGGCAAGAAGTCTCGACACGGAGAAGTACGAACCGTTCTGGATCGGCATCACGACCGGCGGCGAGTGGAAGC
TCTGTGACGGCCCCGACGCGGATTGGGAGAATCGCAGCGCCCGTCCCGCCGTGCTGTCACCCGATCGAAGTGTGCACGGC
CTGCTGGTCATGGAGCAGGGGGGCTACGAAACCGTGCGCCTCGACCTCGTCTTCCCCGTACTTCACGGCAAGCTCGGCGA
AGACGGCGCGATCCAAGGCCTGTTGGAGCTCGCCGGCATCCCCTACGTCGGCTGCGACATCCAGGGCTCGGCTGTGTGCA
TGGACAAGGCCCTGGCCTACATCGTGGCCAAGAGCGCGGGAATCGCCACGCCGAGCTTTTGGGTTGTCGCGGAGAACGAG
AAGGTCGACGCCGATCACCTTCGCTATCCGGTCTTCGTGAAGCCGGCCCGTTCGGGTTCATCTTTCGGCGTCAGCAAGGT
CACCCGAGAAGACGAGCTGCCGAACGCGCTGAGCGCGGCGCGACAGTACGACTCGAAGGTCCTGATCGAAGAAGCCGTGG
CCGGCAGCGAGATCGGCTGCGCGGTCATGGGTGAACTATTCGGCCTGATCACTGGGGAGGTGGACCGCGTCGACCTCTCG
CACGGATTCTTCAGGATCCACCAGGAGGACTCACCCGAAACCGGATCGGAGAACTCGACGTTCATCGTTCCCGCCGACAT
CTCCGACGAATCGCGCCGGCTCGTCCAAGAGACCGCCAAGGCCATCTACCGCACCCTGGGCTGCAAGGGACTTGCCCGCG
TTGACATGTTCCTCACCGACGACGGACGGGTGGTCCTCAACGAGGTCAACACCATGCCCGGCATGACGTCGTACAGCCGG
TACCCGCGGATGATGGCCGCCGCGGGACTGCCGATCTCCGACATGATCGACCGGCTCATCTCGATGACAATGCACGGGAA
GAAGCGATGAACGACGACTTCGTCTACGTCGACGACTGGGTGCCCGGAGTCCGCTGGGATGCCAAGTACGCCACGTGGGA
CAACTTCACCGGCAAACCGGTAGACGGCTACCTCGCGAATCGAATCGTCGGCACCCGGGCTTTGTGCGCGGCCCTCGAGC
AAGCACGCGAGAAGGCAGCTTCCCTCGGCTTCGGATTGCTTCTCTGGGACGGCTACCGTCCTCGACGCGCCGTCGACAGC
TTCCTACGCTGGTCAGAACAGCCGGAGGATGGCCAGACGAAGCAGCGACACTATCCCAATATCGACAGACCCGAGATGCT
CGAAAAGGGATACGTGGCAACCCAGTCGGGCCACAGTAGGGGCGGCGCCGTTGACCTGACGCTCTATCACCTTGCGACCG
GTGAACTTGCTCCTATGGGTGGCGACCACGACCTCATGGACCCGATCTCACATCATCGAGCGCGAGGAATCAAGCCAATC
GAGTCCAAGAATCGTGAGCTTCTTCGTTCCATCATGGAGGACTGCGGATTTGATCGGTACGACTGCGAGTGGTGGCACTA
CACGCTGAAACGCGAACCATATCCAGATGTCTACTTCGACTTTCCGATCACGTGA