MEGAResFrom MEG, the Microbial Ecology Group

VAND

The vanD gene encodes a D-ala-D-lac ligase. This gene is part of the VanD operon and is a core resistance gene.

References

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>Gly|VanA-D_4_AY89045|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAAAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGACCCATGGCCTGCTGATA
CAAAAGGATGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAACCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGAAA
GCAGAGACACTCTCGTACCCGGTCTTTGTAAAACCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGCAAGTATGACTGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGCTGTGCCATACTGGGAAATGAAAATGCTCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGGTTTT
TTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGTTCTGAAAATGCAGTTATCAGAGTTCCAGCTGTCTTACCGGATGA
GGTAAGAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCCGAGGATTGGCTCGTATTGATCTGT
TTTTGCGGGAGGACGGCTGCATTGTGCTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCCCCGC
ATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAA

>1428|AY082011.1|AY082011|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCTGATA
CAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAATCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGGAA
GCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGGGTTT
TTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGGATGA
AGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGATTTGT
TTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCCGGATTTACTTCCTATAGCCGTTATCCACGC
ATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAA

>Gly|VanA-D_1_AB242319|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCTGATA
CAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGTATGCGACATTCAAAGTTCTGTAATCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGGAA
GCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGGGTTT
TTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGGATGA
AGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGATTTGT
TTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCTGGATTTACTTCCTATAGCCGTTATCCACGC
ATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAA

>1379|AF175293.1|AF175293|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTTTAGAATTAAAGTTGCAGTTCTGTTTGGGGGCTGTTCAGAGGAACATAATGTTTCGATAAAATCTGCGATGGAGAT
TGCCGCAAACATAGATACAAAAAAGTATCAGCCTTATTATATTGGAATCACAAAATCCGGCGTTTGGAAAATGTGTGAAA
AACCTTGTTTGGAGTGGGAACAATATGCGGGGGATCCGGTTGTTTTTTCACCGGACAGAAGTACGCATGGTCTGCTGATA
CAAAAAGACACTGGGTATGAAATCCAGCCTGTGGATGTGGGATTACCGATGATTCATGGCAAGTTTGGCGAGGATGGCTC
CATACAAGGCTTGCTTGAATTGTCAGGCATTCCGTATGTGGGATGCGATATTCAAAGCTCCGTGACCTGCATGGATAAGG
CGCTTGCATATACCGTTGTGAAAAATGCGGGTATCGCTGTGCCTGGGTTCCGGATCCTTCAGGAGGGGGATCGCCTGGAA
ACAGAGGATTTCGTATATCCCGTTTTTGTAAAGCCTGCCCGTTCCGGCTCATCCTTTGGCGTAAACAAGGTATGCAAGGC
AGAAGAACTGCAGGCAGCAATCGAAGATGCAAGAAAATATGACAGCAAGATTTTGATTGAAGAGGCCGTTACCGGGAGTG
AGGTAGGCTGCGCCATACTGGGAAACGGAAATGATCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGGCTTT
TTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGATCTGAAAATGCAGTCATCCGAGTTCCAGCCGCCTTACCGGATGA
GGTAATAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCAGAGGATTGGCCCGCATTGACCTGT
TTTTGCGGGAGGACGGCTGCATTGTGTTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCCCCGC
ATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAA