MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VAND

The vanD gene encodes a D-ala-D-lac ligase. This gene is part of the VanD operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type resistance protein

Sequences

Download Sequences

>>MEG_7383|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
atgtataggattaacgttgcggtcctgtttgggggctgctcagaagaacatactgtatcaataaagtctgcaatggagct
tgcggcaaacattgatacggaaaaatatcagcctttttatatcgggatcacaaaatccggtgtttggaaattgtgtgaaa
agccctgcctggattgggaacaatatgcaaaatatccggtcgtcttttcgccgggcagaaatacgcatggttttctgata
caaaaagaggatagatatgaaatccaacctgtagatgtagtgttccccatcattcatggaaaattcggagaagatggctc
aatacaggggctgctcgaattatcgggtattccctatgttggctgtgatattcaaagctccgtgatttgcatggataaat
cgcttgcttatactaccgtaaaaaatgcaggtattgaagtccctgattttcagattatccaggacggtgacagcccgaaa
accgagtgctttagctttcctctttttgtgaaacctgcacgctctggttcttcttttggagtaaataaagtagataaagc
ggaggatttatgcgctgccataaacgaagcaaggcaatatgacagaaaagtattgattgagcaggccgtttctggaagtg
aggttggctgcgccgtattgggaaccggtacggacctaattgtcggagaggtcgatcagattagcctaaaacatggcttt
tttaagattcatcaggaagcacagcctgaaaaggggtctgaaaatgcaacgatcgaagtgccggctgatcttccggcaaa
ggtaagagagcggattcagaaaacagctaagaagatttatcaggtgctcggctgcagaggactggcccgtattgatttgt
ttttgcgggaggacgggcatattgtcctcaatgaagtgaataccatgcccggttttacttcgtatagccgctatccctgt
atgatgactgcggcaggctttaccctttcggaactcattgatcgtttgattgaactggcgctcaggaggtag

>>MEG_7384|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
atgtttaagattaaagttgcagttctgtttgggggctgttcagaggaacataatgtttcgataaaatctgcgatggagat
tgccgcaaacatagatacaaaaaaatatcagccttattatattggaatcacaaaatccggcgtttggaagatgtgtgaaa
aaccttgtttggggtgggaacaatatgcgggggatccggttgttttttcgccggacagaagtacgcatggtctgctgata
caaaaagacactgggtatgaaatccagcctgtagatgtggtatttccgatgattcatggcaagtttggcgaagatggatc
catacaaggcttgcttgaattgtcaggcattccgtatgtgggatgcgatattcaaagctccgtgatctgcatggataagg
cgcttgcatataccgttgtgaaaaatgcgggtatcgctgtgcctgggttccggatccttcaggagggggatcgcctggaa
acggaggatttagtatatcccgtctttgtaaagcctgcccgttctggctcatcctttggcgtaaacaaggtatgcaaggc
agaagaactgcaggcagcaatcagagaagcaagaaaatatgatagcaagattttgattgaagaggccgttaccgggagtg
aggtaggctgcgccatactgggaaacgaaaatgatctcatggctggcgaggtggatcagattgagctgagacacggcttt
tttaagattcatcaggaagcacagccggagaagggatctgaaaatgcagttatcagagttccagccgccttaccggatga
ggtaagagaacggattcggaaaacagcaatgaagatttaccggatacttggctgccgaggattggcccgtattgatctgt
ttttgcgggaggacggctgcattgtgctgaatgaagtgaataccatgccgggttttacttcctacagccgttatccccgc
atgatgacagcagccggttttacgctttctgaaatactggatcgcttgattgaattttcacttaggaggtaa

>>MEG_7385|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
atgtttaagattaaagttgcagttctgtttgggggctgttcagaggaacataatgtttcgataaaatctgcgatggagat
tgccgcaaacatagatacaaaaaagtatcagccttattatattggaatcacaaaatccggcgtttggaaaatgtgtgaaa
aaccttgtttggagtgggaacaatatgcgggggatccggttgttttttcgccggacagaagtacgcatggtctgctgata
caaaaagacaaagggtatgaaatccagcctgtagacgtggtattaccgatgattcatggcaagtttggcgaagatggctc
catacaaggcttgcttgaattgtcaggcattccgtatgtgggatgcgatattcaaagctccgtgacctgcatggataagg
cgcttgcatataccgttgtgaaaaatgcgggtatcgctgtgcctgggttccggatccttcaggagggggatcgcctggaa
acggaggatttcgtatatcccgtttttgtaaagcctgcccgttccggctcctcctttggcgtaaacaaggtatgcaaggc
agaagagcttcaggcagcaatcgaagaagcaagaaaatatgacagcaagattttgattgaagaggccgttaccgggagtg
aggtaggctgcgccatactgggaaacggaaatgatctcatggctggcgaggtggatcagattgagctgagacacggcttt
tttaagattcatcaggaagcacagccggagaagggatctgaaaatgcagtcatccgagttccagccgccttaccggatga
ggtaagagaacggattcagaaaacagcaatgaagatttaccggatacttggctgcagaggattggcccgcattgacctgt
ttttgcgggaggacggctgcattgtgctgaatgaagtgaataccatgccgggttttacttcctacagccgctatccccgc
atgatgacagcagccggttttacgcttactgaaatactggatcgcttgattgaactttcacttaggaggtaa

>>MEG_7386|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
atgtttagaattaaagttgcagttctgtttgggggctgttcagaggaacataatgtttcgataaaatctgcgatggagat
tgccgcaaacatagatacaaaaaaatatcagccttattatattggaatcacaaaatccggcgtttggaaaatgtgtgaaa
aaccttgtttggagtgggaacaatatgcgggggatccggttgttttttcgccggacagaagtacgcatggtctgctgata
caaaaagacaaagggtatgaaatccagcctgtggatgtggtgtttccgatgattcatggcaagtttggggaggatggctc
catacaaggcttgcttgaattgtcaggcattccgtatgtgggatgcgatattcaaagctccgtgatctgcatggataagg
cgcttgcatataccgttgtgaaaaatgcgggtatcactgtgcctgggttccggatccttcaggagggggatcgcctggaa
acggaggatttcgtatatcccgtttttgtaaagcctgcccgttccggctcatcctttggcgtaaacaaggtatgcaaggc
agaagaactgcaggcagcaatcgaagaagcaagaaaatatgacagcaagattttgattgaagaggccgttaccgggagtg
aggtaggctgcgccatactgggaaacggaaatgatctcatggctggcgaggtggatcagattgagctgagacacggcttt
tttaagattcatcaggaagcacagccggagaagggatctgaaaatgcagtcatccgagttccagccgccttaccggatga
ggtaagagaacagattcaggaaacggcaatgaagatttaccggatacttggctgcagaggattggcccgcattgacctgt
ttttgcgggaggacggttgcattgtgctgaatgaagtgaataccatgccaggttttacttcctacagccgctatccccgc
atgatgacagcagccggttttacgctttctgaaatactggatcgcttgattgaactttcacttaggaggtaa

>>MEG_7387|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAGAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGATCCATGGCCTGCTGATA
CAAAAGGACGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGTATGCGACATTCAAAGTTCTGTAATCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGGAA
GCAGAGACGCTCTCGTATCCGGTCTTTGTAAAGCCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGTAAGTATGACAGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGATGTGCCATACTGGGAAACGGAAACGATCTCATCACCGGCGAGGTCGATCAGATTGAATTGAAACACGGGTTT
TTTAAGATCCATCAGGAAGCACAGCCGGAAAAGGGGTCTGAAAATGCTGTGATTAGAGTTCCAGCCGCCCTGCCGGATGA
AGTTAGGGAGCAGATTCAGGAAACGGCGAAGAAGATTTACCGGGTACTTGGCTGCAGAGGTCTGGCCCGCATTGATTTGT
TTTTACGGGAGGATGGAAGCATTGTCCTGAATGAAGTGAACACCATGCCTGGATTTACTTCCTATAGCCGTTATCCACGC
ATGATGACAGCAGCAGGGTTTACGCTTTCTGAAATATTGGACCGCTTGATTGGACTTTCACTTAGGAGGTAA

>>MEG_7388|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTATAAGCTTAAAATTGCAGTCCTGTTTGGAGGCTGCTCAGAGGAACATGATGTTTCAGTGAAATCTGCGATGGAGGT
TGCAGCAAATATAAACAAGGAAAAATACCAGCCGTTTTATATTGGAATCACAAAATCCGGCGCATGGAAACTATGCGATA
AGCCCTGCCGGGACTGGGAAAACTATGCGGGATACCCGGCTGTGATTTCTCCGGACAGAAGGACCCATGGCCTGCTGATA
CAAAAGGATGGCGGATATGAGAGCCAGCCTGTAGACGTGGTGCTTCCGATGATTCATGGAAAATTTGGCGAGGACGGAAC
CATACAGGGTCTGCTTGAGCTGTCCGGCATTCCTTATGTGGGATGCGACATTCAAAGTTCTGTAACCTGTATGGATAAGT
CGCTCGCTTATATGGTTGTGAAAAATGCGGGAATTGAGGTACCTGGGTTTCGAGTTCTACAAAAGGGGGACAGCCTGAAA
GCAGAGACACTCTCGTACCCGGTCTTTGTAAAACCTGCCCGTTCCGGCTCCTCTTTTGGCGTGAATAAGGTATGCCGGGC
AGAGGAACTGCAGGCAGCGGTCACAGAGGCGGGCAAGTATGACTGCAAAATATTGGTTGAGGAGGCCGTTTCCGGGAGTG
AGGTAGGCTGTGCCATACTGGGAAATGAAAATGCTCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGGTTTT
TTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGTTCTGAAAATGCAGTTATCAGAGTTCCAGCTGTCTTACCGGATGA
GGTAAGAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCCGAGGATTGGCTCGTATTGATCTGT
TTTTGCGGGAGGACGGCTGCATTGTGCTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCCCCGC
ATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAA

>>MEG_7389|Drugs|Glycopeptides|VanD-type_resistance_protein|VAND
ATGTTTAGAATTAAAGTTGCAGTTCTGTTTGGGGGCTGTTCAGAGGAACATAATGTTTCGATAAAATCTGCGATGGAGAT
TGCCGCAAACATAGATACAAAAAAGTATCAGCCTTATTATATTGGAATCACAAAATCCGGCGTTTGGAAAATGTGTGAAA
AACCTTGTTTGGAGTGGGAACAATATGCGGGGGATCCGGTTGTTTTTTCACCGGACAGAAGTACGCATGGTCTGCTGATA
CAAAAAGACACTGGGTATGAAATCCAGCCTGTGGATGTGGGATTACCGATGATTCATGGCAAGTTTGGCGAGGATGGCTC
CATACAAGGCTTGCTTGAATTGTCAGGCATTCCGTATGTGGGATGCGATATTCAAAGCTCCGTGACCTGCATGGATAAGG
CGCTTGCATATACCGTTGTGAAAAATGCGGGTATCGCTGTGCCTGGGTTCCGGATCCTTCAGGAGGGGGATCGCCTGGAA
ACAGAGGATTTCGTATATCCCGTTTTTGTAAAGCCTGCCCGTTCCGGCTCATCCTTTGGCGTAAACAAGGTATGCAAGGC
AGAAGAACTGCAGGCAGCAATCGAAGATGCAAGAAAATATGACAGCAAGATTTTGATTGAAGAGGCCGTTACCGGGAGTG
AGGTAGGCTGCGCCATACTGGGAAACGGAAATGATCTCATGGCTGGCGAGGTGGATCAGATTGAGCTGAGACACGGCTTT
TTTAAGATTCATCAGGAAGCACAGCCGGAGAAAGGATCTGAAAATGCAGTCATCCGAGTTCCAGCCGCCTTACCGGATGA
GGTAATAGAACGGATTCAGAAAACAGCAATGAAGATTTACCGGATACTTGGCTGCAGAGGATTGGCCCGCATTGACCTGT
TTTTGCGGGAGGACGGCTGCATTGTGTTGAATGAAGTGAATACCATGCCGGGTTTTACTTCCTACAGCCGTTATCCCCGC
ATGATGACAGCAGCCGGTTTTACGCTTACTGAAATACTGGATCGCTTGATTGAACTTTCACTTAGGAGGTAA