MEGAResFrom MEG, the Microbial Ecology Group

VANSD

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanD operon and is a regulator gene.

References

Other Groups in VanD-type regulator

Sequences

Download Sequences

>CARD|phgb|EU999036|688-1390|ARO:3002934|vanSD|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAAATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGATTGTCCGTTAAAATATTGCTTAT
GATGGCGTGCTCCATTCTGATTATTGCGGGTGTTTATCTGTTTATCTTAAAAGATAATTTTGCAAATGTCGTGGTAGCCA
TTTTAGACAGCTTTATCTATCATGATCGGGATGAGGCGGTGGTTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATAGCGGTTATGGGTGTGTTTTTTATGATCTTTCGCCGCTATCTGGACAGCATTTCAAAATATTTTAAGGA
GATCAACCGTGGGATCGATACTTTGGTGAATGAGGATGCCAACGATATCACATTGCCTCCGGAGTTGGCTTCGACCGAAA
GGAAAATCAATTCCATACGGCATACCCTGACGAAACGGAAAACGGACGCTGAGCTTGCAGAGCAAAGGAAAAACGACCTT
GTCATGTATCTGGCCCATGACCTGAAGACCCCGCTTTCATCGGTCATAGGATATTTGAACCTATTAAGGGATGAGAATCA
GATCTCCGAGGAACTCAGGGAAAAATATCTGTCCATATCATTGGATAAGGCTGAGCGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTAATCTTTCAAATATCACGCTTGTGTACAGCAAAATCAATCTGA

>1436|AY489045.1|AY489045|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAGATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGACTGTCCCTTAAAATACTGCTGAT
AATGGCATGCTCCATTCTAATTATAGCGGCAGTGTATCTATTCGTTTTAAAAGATAATTTTGCAAATGTGGTGGTAGCCA
TTTTAGATAGCTTTATCTATCATGATCGGGATGAGGCGGTGGCTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTTCTGATAGCGGTTATGGGTGTGTTTTTTATGATCTTTCGCCGTTATCTGGACAGTATCTCAAAGTATTTTAAGGA
GATCAACCGGGGGATTGATACCCTGGTGCATGAAGATACCAATGATATCGCCCTGCCTCCGGAACTGGCTTCGACCGAAA
GAAAAATCAATTCCATACGGCATACACTGACGAAACGGAAAACGGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTTATGTACCTGGCTCATGACTTGAAGACTCCGCTTTCATCGGTTATAGGGTATTTAAACCTGTTAAGGGATGAGAATCA
AATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAAGCTGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAAACATCACGCTTGTGTACAGCAAAATCAATCTGACGATGATGCTGGAACAG
CTGGGGCACGAGTTTAAGCCGATGTTGGCCGGGAAAAATCTCAAATGTGAATTTGATGTTCAGCCGGACATGATGCTGTC
CTGTGATGCCAACAAACTGCAGAGAGTGTTCGATAATGTGCTGAGAAATGCCGTCAGCTACTGTTATGAGAATACTACCA
TTCAGGTGAATGCCAGGCAGGCGGAAGACTATGTGCTCATCCAAGTCATAAACGAAGGGGATACGATTCCCGGGGAGAGA
TTGGAAAGAATCTTTGAGCAGTTTTACCGCCTGGATGTGTCACAAAGCTCAAGCACCGGCGGAGCCGGTCTGGGACTTGC
GATTGCAAGGGAGATTGTGGAACTGCACCATGGACAGATCACTGCCCGCAGCGAAAACGGTATCACCAGTTTTGAGGTTA
CATTGCCCACCGTAGGAAAATCGTAA

>1376|AF175293.1|AF175293|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAGAAATAAAACCAGTCATGAAGATGACTATTTACTTTTTAAAAACAGATTGTCCGTTAAAATACTGCTTAT
GATGGTATATTCCATTCTGATTATTGCGGGCGTTTATCTGTTTATCTTAAAAGATAATTTTGCAAATGTCGTGGTAGCTA
TTTTAGACAGTTTTATCTATCATGATCGGGATGAGGCGGTGGCTGTTTATCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATAGCGGTTATGGGCGTGTTTTTTATGATCTTCCGCCGTTATCTGGACAGTATTTCAAAATATTTTAAGGA
GATCAACCGGGGGATCGATACTTTGGTGAATGAGGATGCCAACGATATTGGGCTGCCTCCGGAGTTGGCTTCGACCGAAA
GAAAAATCAATTCCATACGGCATACCCTGACGAAACGGAAAACGGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTCATGTACCTGGCTCATGACTTGAAGACTCCGCTTTCATCGGTCATAGGATATTTGAACCTGTTAAGGGATGAGAATCA
GATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAGGCTGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAACATCACGCTTGTGTACAGCAAAATCAATCTGA

>Gly|VanS-D|AB242319|689-1834|1146|Glycopeptides|VanD-type_regulator|VANSD
TTGAAAAATAAAAATATGACCAGTTATGAGGATGACTATTTACTTTTTAAAAACAGACTGTCCGTTAAAATACTGCTGAT
GATGGCGTGCTCCATTCTGATTATATCGGTGGTTTATCTGTTCGTCTTAAAGGATAATTTTGCAAATGTGGTGGTAGCCA
TATTGGACCGTTTCATTTATCATGACCGGGATGAAGCGGTGGCTGTTTACCTGAGAACCTTTAAGGCGTATGAGATATGG
CTTTTCCTGATCGCCGTCATGGGTGTGTTTTTCGTTATTTTTCGTCGTTATCTGGACAGCATCTCAAAGTATTTTAAGGA
GATCAACCGGGGGATTGATACACTGGTGCATGAAGATACCAATGATATCGCCCTGCCTCCGGAACTGGCTTCGACCGAAA
GGAAAATCAATTCCATACGGCATACCCTGACGAAGCGGAAAACAGACGCCGAGCTTGCGGAACAGCGGAAAAACGACCTT
GTCATGTACCTGGCTCATGACTTGAAGATCCCGCTTTCATCGGTCATAGGGTATTTGAACCTGTTAAGGGATGAGAAGCA
GATCTCCGAGGAACTCCGGGAAAAATATCTGTCCATTTCACTGGATAAGGCGGAACGTCTGGAAGAGCTGATCAATGAGT
TTTTTGAAATTACGAGGTTTAATCTTTCAAACATCACGCTTGTGTACAGCAAAATCAATCTGACGATGATGCTGGAACAG
CTGGGGCACGAGTTTAAGCCGATGCTGGCCGGGAAAAATCTCAAATGTGAATTTGATATTCAGCCGGACATGCTGCTGTC
CTGTGATGCCAACAAGCTGCAGAGAGTGTTTGATAATCTGCTGAGAAATGCCGTCAGCTACTGTTATGAGAACACCACCA
TTCAGGTGAATGCCAGGCAGGCGGAAGATCATGTGCTCATCAAAATCATAAACGAAGGGGATACGATTCCGCGGGAAAGG
TTAGAAAGAATCTTTGAGCAGTTTTATCGCCTTGATATGTCGCGAAGCTCAAGCACCGGCGGAGCCGGTCTGGGACTTGC
GATTGCAAGGGAGATTGTGGAACTGCACCATGGACAGATCACTGCCCGCAGCGAAAACGGTATCACCAGTTTTGAGGTTA
CATTGCCCACCGTAGGAAAATCGTAA