MEGAResFrom MEG, the Microbial Ecology Group

VANRD

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanD operon and is a regulator gene.

References

Other Groups in VanD-type regulator

Sequences

Download Sequences

>Gly|VanR-D_2_AF175293|Glycopeptides|VanD-type_regulator|VANRD
ATGAATGAAAAAATCTTAGTGGTTGATGATGAAAAAGAATTGGCCGATTTAGTTGAAGTATATCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAAGGATGCACTAAAGTGTATTGAATCCGTGGAACTGGATTTAGCCATATTGGATA
TCATGCTTCCGGATGTAGACGGGTTTCAGATCTGCCAGAAAATCCGGGAAAAGTTTTACTTCCCTGTTATCATGCTGACG
GCAAAAGTGGAGGACGGGGATAAAATCATGGGACTGTCCGTGGCGGATGATTATATTACGAAGCCGTTTAACCCGCTGGA
ACTGGTTGCGAGGGTAAAGGCGCAGCTAAGGCAGTACATGCGGTACAAGCAGCCCGGCATAAAGCAGGAGGCTGAACGCA
CGGAATACGATATCCGGGGAATGACAATCAGCAAGAGCAGCCATAAGTGTATCCTGTTTGGAAAGGAAATTCAGCTGACG
CCAACAGAGTTTTCCATCCTTTGGTATCTGTGCGAGCGTCAGGGTACGGTTGTTTCTACGGAGGAATTATTTGAGGCAGT
ATGGGGTGAACGGTTTTTTGACAGCAATAATACTGTGATGGCGCATATCGGGCGGCTTCGGGAGAAAATGAAGGAACCGT
CAAGAAATCCGAAATTTATAAAAACTGTGTGGGGAGTGGGATATACCATTGAAAAATAG

>1435|AY489045.1|AY489045|Glycopeptides|VanD-type_regulator|VANRD
ATGAATGAAAAAATCTTAGTGGTTGATGATGAAAAAGAATTGGCCGACTTAGTTGAAGTATATCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAAGGATGCACTAAAGTGTATTGAATCCGTGGAACTGGATTTAGCCATATTGGATA
TCATGCTTCCGGATGTAGACGGGTTTCAGATCTGCCAGAAAATCCGGGAAAAGTTTTACTTCCCTGTTATCATGCTGACA
GCAAAAGTGGAGGACGGGGATAAAATCATGGGACTGTCTGTGGCAGATGATTATATTACGAAGCCGTTTAACCCGTTGGA
AGTGGTTGCGAGGGTAAAGGCGCAGCTAAGGCAGTACATGCGGTACAAGCAGCCCAGCTTAAAGCAAGAGGCTGAATGCA
CAGAATACGATATCAGAGGGATGACAATTAGCAAGAGCAGCCATAAGTGTATCTTGTTTGGAAAGGAGATTCAGCTGACG
CCAACGGAATTTTCGATTCTTTGGTATCTGTGCGAGCGTCAGGGGACGGTTGTTTCTACGGAGGAATTATTTGAAGCAGT
ATGGGGGGAACGGTATTTTGACAGCAATAATACCGTGATGGCGCATATCGGACGTCTCCGGGAAAAAATGAAGGAACCGT
CAAGAAATCCGAAATTTATAAAAACCGTGTGGGGAGTGGGATATACCATTGAAAAATAG

>Gly|VanR-D|AB242319|1-699|699|Glycopeptides|VanD-type_regulator|VANRD
ATGAATGAAAAAATCTTAGTGGTTGACGATGAAAAAGAGTTGGCCGACTTAGTTGAAGTGTACCTGAAAAACGATGGATA
TACCGTTTATAAATTTTATAATGGCAGGGACGCATTAAATTGCATTGAATCCGTGGAACTGGATTTAGCCATACTGGATA
TCATGCTCCCGGATATTGACGGTTTTCAAATCTGCCAGAAAATCCGGGAGAAGTTCTACTTCCCTGTTATCATGCTGACA
GCGAAAGTAGAAGATGGGGATAAAATCATGGGGCTGTCCGTTGCAGATGATTATATTACGAAGCCGTTTAATCCGCTGGA
AGTGGTTGCGAGGGTAAAGGCACAGCTAAGGCAGTACATGCGGTACAAGCAGCCCTGCATAAAGCAGGAGGCTGAACGCA
CGGAATACGATATCCGGGGGATGACAATCAGCAAGAGCAGCCATAAGTGTATCTTGTTTGGAAAGGAAATTCAACTGACA
CCAACGGAATTTTCGATCCTTTGGTATCTGTGCGAGCGTCAGGGAACGGTAGTTTCTACGGAGGAATTATTCGAGGCAGT
ATGGGGCGAGCGGTATTTTGACAGCAATAATACCGTGATGGCGCATATTGGGCGTCTCAGAGAGAAAATGAAGGAACCGT
CAAGAAACCCGAAGTTCATAAAAACCGTGTGGGGAGTTGGATATACCATTGAAAAATAA