MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANYD

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanD operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanD-type accessory protein

Sequences

Download Sequences

>>MEG_7599|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
atgatggaatatcaaaacaataatggaaactatgacaaaaggaatcgtagaaaagccaaaaaaagaaaattgctttttta
cagggctgcatgtgtcacactttgtttgctcattgtttctgtaatctttggagttgtgcattttttaggggagagtaaag
atcccggccttttatccaaagaaaacacaaaaacagacaagaactattcgtggcttaccgacgatcagaatgaggcagta
ccctcagttccagagccagccatatccgaccaggctaacaaaatttcggtaaatatcacagcggcaaacgccattgtaat
gaataaagacacaaatgaggtattgtaccagaaaaaaagcacagccaaaattgcgccggccagcactgctaagatgatta
tggctttgacagcacttgactattgttccccggaggatgaaatgaaagtaggtgcggagattggaatgattcaaagcgat
tcgtcaaccgcatggcttatgaagggtgatacactgactgtcagacagctcctgattgcccttatgcttccgtccggcaa
tgatgcagcctatacccttgcagtcaataccggaaaggctattgcaggtgataacagcctgaccagtcagcaagcgattg
aagtattcatggataaggtaaatgaaaaagccgtggcccttggcgccacaaactcgaaatttgtagctccggatggatat
gatgccgaagggcagtatactacagcttatgaccttgctatcattgcaaaagcatgtttggacaatcctatcatttcgga
gattgtagcgagttattcatcctatgaaaaatggtcaaacggaagagaggtcacttacaacaattccaatgagcttctcg
atccgaacagtccctattaccgtccggaggttatcggtttgaaaacaggaaccagcagtcttggcggcgcatgtattgtt
tctgcagcggtgatggacggagaaacctatatctgtgtagttatgggttctacaaaggaaagcaggtttcaggacagcgt
tgatattttagataaaatcaaagcccagtaa

>>MEG_7600|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
atgatggaatatcaaaacaataatggaaactatgacaaaaggaatcgtagaaaagccaaaaaaagaaaattgctttttta
cagggctgcatgtgtcacactttgtttgctcattgtttctgtaatctttggagttgtgcattttttaggggagagtaaag
atcccggccttttatccaaagaaaacacaaaaacagacaagaactattcgtggcttaccgacgatcagaatgaggcagta
ccctcagttccagagccagccatatccgaccaggctaacaaaatttcggtaaatatcgcggcagcaaacgccattgtaat
gaataaagacacaaatgaggtattgtaccagaaaaaaagcacagccaaaattgcgccggccagcactgctaagatgatta
tggctttgacagcacttgactattgttccccggaggatgaaatgaaagtaggtgcggagattgaaatgattcaaagcgat
tcgtcaaccgcatggcttatgaagggtgatacactgactgtcagacagctcctgattgcccttatgcttccatccggtaa
tgatgcggcctatacccttgcagtcaatactggaaagaagattgcaggagataaaagcctgacccatcagcaagcgattg
aagtattcatggataaggtaaatgaaaaagccgtgaaccttggcgccacaaactcgaaatttgtagctccggatggatat
gatgccgaaggccagtatactacagcttacgaccttgctatcattgcaaaagcatgtttggacaatcctatcatttcgga
gattgtagcgagttattcatcctatgaaaaatggccaaacggaagagaggtcacttacagcaattccaatgagcttctcg
atccgaacagtccctattaccgtccggaggttatcggtttgaaaacaggaaccagcagccttggcggcgcatgtattgtt
tctgcagcggtgattgacggagaaacctatatctgtgtagttatgggctctacaaaggaaagcaggtttcaggacagtgt
tgatattttagataaaatcaaagcccagtaa

>>MEG_7601|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
atggattataagaacattaacggaaattacgataacaggaacaggagaaaatcaaaaaagaaaaaaagagtttattacag
aactgtatgtatcgtgctcggtttactcatagccgttgcagcacttgggattgtgaatctgataaggggcgacaaagaaa
ctccctcccccggcaaaaacgaggcttattctctggtagatggcgaacaaaacgagacagtcttcccctctcttgactct
gctgaaaattctctttccgtaaacattacggcagcaaatgcgattgtaatcaacgctgatacaaatgagacattgtatca
gaaaaaaagtacagataaaattgcgccggccagcacagctaagatgattacagccttgacggtgctggattactgttccc
cgaacgatgaaatgagggtgggcgcggaaattgaattgatgcatgatgattcgtcaagggcatggcttatgcagggcgat
accctgaccgtcagacagctcttagttgcccttatgcttccttctggcaatgatgcggcgtatacgcttgctgtgaatac
cggaaagaaaattgccggagataacggcctgtcaaatgcacagtccattgatgtgttcatggataaagtaaaccaaaagg
caaaatcgcttggagcggaaaactcgaattttgtagtcccggacggatatgacgccgatgggcagtatactacggcctac
gatctcgccgttattgcaaaggcatgtttggatgacccttatatttcagagatcgtggcaagctactcgtcttatgaaag
atggccgaatggccgggaggtcacttacaacaatacaaacgaacttctcaatccaaacagcccgtattatcggccagaag
tgatcggcctaaaaacgggaaccagcagtctcggcggtgcctgtatcgtttctgctgctgtcattaacgggaacacctat
atctgtgcagtcatgggctccactgagaacgacaggttccaggacggcatcgatataattgatgcaataaaattacaatg
a

>>MEG_7602|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
gtggaacgtcaaaataacaatgaaaaccagtatggaagaaaccgcagaaaagacaaaagaagaaaattgtttttttacag
agcagcatgtgccatgctcggtctgctcatagtctctgtaatttttggagctgtgtattttctgagagagagtaaagatc
ccgctcttccatccaaagaaaatacaaagacaagcaaggactattcatttctggccgacgttcagagtgaggatgagtct
ccagtttcggagccagccatatccaaccgggcgaatacgattgacctgaacatcatagcagcaaatgccattgtggtgaa
taaagacaccgatgcggtattgtatcaaaaaaacggcacggacagaattgcgccggccagtacagccaaaatgattacag
cgttgactgtgcttgaatattgttctccggaggaggagatgagggtaggtgcagagattgaaatgatccatagtgattcg
tcaaccgcatggcttatgaaaggcgataccctgactgtcaggcagctcctgattgcccttatgcttccgtccggcaatga
tgcagcctatacccttgcagtcaataccggaaagacgattgcgggtgataacagcctgtccaatcagcaggccattaaaa
tattcatggataaggtgaacgagaaggccagggagcttggcgttacagactcgaattttgtggttccggatgggtatgac
gccgagggacagtataccacggcctatgatcttgccatcattgcaaaggcatgtttggagaatcccattatttcagaaat
tgtggcaagcaatacgtcgtatgaaaaatggccgaacggcagggaggtcacttacaacaattccaatgagcttcttgatc
cgaacagtccctattaccgtccggaggtgatcggtctgaaaaccgggaccagcagccttggcggcgcctgtgtcgtctcc
gcagcagtgattgacggagaaacctatatctgcgtagccatgggctctacgaaagaaagcaggtttcaggacagcgttga
tattttagataaaatcaaagcccagtaa

>>MEG_7603|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
GTGGAACGTCAAAATAACAATGAAAACCAGTATGGAAGGAATCGCAGAAAAGACAAAAGAAAAAAATTGTTTTTTTACAG
AGCAGCATGTGCCATGCTCGGTCTGCTCATAGTCTGTGTAATTTTTGGAGCTGTGTATTTTCTCAGAGAGAGTAAAGATC
CGGTTCTTCCATCCAAAGAAAATACAAAGACAGGCAAGGACTATTCATTTTTGGCCGACGGTCAGAGTGAGGATGAGTCT
CCGATTTCGGAGCCAGCCATATCCAACCGGGCGAATGCGATTGACCTGAACATCATAGCAGCAAATGCCATTGTGATGAA
TAAAGACACCGATGCGTTATTGTATCAAAAAAACGGCACGGACAGAATTGCGCCGGCCAGTACAGCAAAGATGATTACGG
CGTTGACCGTGCTTGAATATTGTTCTCCGGAGGAGGAGATGAGAGTCGGTGCAGAGATTGAAATGATCCATAGTGATTCG
TCAACCGCATGGCTTATGAAAGGCGATACCCTGACTGTCAGGCAGCTCCTGATTGCCCTGATGCTTCCGTCCGGCAATGA
TGCAGCTTATACCCTTGCAGTCAATACCGGAAAGGTTATTGCAGGCGATAACAGCCTGTCCAATCAGCAGGCCATTCAGA
TATTCATGGATAAGGTAAATGAGAAGGCCAGGGCAATTGGTGTTACAGACTCGAATTTTGTGGTTCCGGATGGGTATGAT
GCCGAGGGGCAGTATACCACGGCCTATGATCTTGCCATCATTGCAAAGGCATGTTTGGAGGATCCCATTATTTCAGAAAT
TGTGGCGAGCAATACGTCGTATGAAAAATGGCCGAACGGCAGGGAGGTCACTTACAACAATTCCAATGAGCTTCTTGATC
CGAACAGTCCCTATTACCGTCCGGAGGTCATCGGACTGAAAACAGGGACCAGCAGCCTTGGCGGCGCCTGTGTGGTCTCT
GCGGCAGTGATTGACGGAGAAACCTATATTTGCGTAGTCATGGGCTCTACGAAAGAAAGCAGGTTTCAGGACAGCGTTGC
CATTTTGGATAAAATCAAGGCCCAGTGA

>>MEG_7604|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
GTGGAACGTCAAAATAACAATGAAAACCAGTATGGAAGGAATCGCAGAAAAGACAAAAGAAAAAAATTGTTTTTTTACAG
AGCAGCATGTGCCATGCTCGGTCTGCTCATAGTCTGTGTAATTTTTGGAGCTGTGTATTTTCTCAGAGAGAGTAAAGATC
CGGTTCTTCCATCCAAAGAAAATACAAAGACAGGCAAGGACTATTCATTTTTGGCCGACGGTCAGAGTGAGGATGAGTCT
CCGATTTCGGAGCCAGCCATATCCAACCGGGCGAATGCGATTGACCTGAACATCATAGCAGCAAATGCCATTGTGATGAA
TAAAGACACCGATGCGTTATTGTATCAAAAAAAACGGCACGGACAGAATTGCGCCGGCCAGTACAGCAAAGATGATTACG
GCGTTGACCGTGCTTGAATATTGTTCTCCGGAGGAGGAGATGAGAGTCGGTGCAGAGATTGAAATGATCCATAGTGATTC
GTCAACCGCATGGCTTATGAAAGGCGATACCCTGACTGTCAGGCAGCTCCTGATTGCCCTGATGCTTCCGTCCGGCAATG
ATGCAGCTTATACCCTTGCAGTCAATACCGGAAAGGTTATTGCAGGCGATAACAGCCTGTCCAATCAGCAGGCCATTCAG
ATATTCATGGATAAGGTAAATGAGAAGGCCAGGGCAATTGGTGTTACAGACTCGAATTTTGTGGTTCCGGATGGGTATGA
TGCCGAGGGGCAGTATACCACGGCCTATGATCTTGCCATCATTGCAAAGGCATGTTTGGAGGATCCCATTATTTCAGAAA
TTGTGGCGAGCAATACGTCGTATGAAAAATGGCCGAACGGCAGGGAGGTCACTTACAACAATTCCAATGAGCTTCTTGAT
CCGAACAGTCCCTATTACCGTCCGGAGGTCATCGGACTGAAAACAGGGACCAGCAGCCTTGGCGGCGCCTGTGTGGTCTC
TGCGGCAGTGATTGACGGAGAAACCTATATTTGCGTAGTCATGGGCTCTACGAAAGAAAGCAGGTTTCAGGACAGCGTTG
CCATTTTGGATAAAATCAAGGCCCAGTGA

>>MEG_7605|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYD
ATGATGGAATATCAAAACAATAATGGAAACTATGACAAAAGGAATCGTAGAAAAGCCAAAAAAAGAAAATTGCTTTTTTA
CAGGGCTGCATGTGTCATACTTTGTTTGCTCATTGTTTCTGTAATCTTTGGAGTTGTGCATTTTTTAGGGGAGAGTAAAG
ATCCCGGCATTTTATCCAAAGAAAACACAAAAACAGACAAGAACTATTCGTGGCTTACCGACGATCAGAAGGAGGCAGTA
CCCTCAGTTTCAGAGCCAGCCATATCCGACCAGGCTAACAAAATTTCGGTAAATATCACGGCAGCAAACGCCATTGTAAT
GAATAAAGACACAAATGAGGTATTGTACCAGAAAAAAAGCACAGCCCAAATTGCGCCGGCCAGCACTGCTAAGATGATTA
TGGCTTTGACAGCACTTGACTATTGTTCCCCGGAGGATGAAATGAAAGTAGGTGCGGAGATTGAAATGATTCAAAGCGAT
TCGTCAACCGCATGGCTTATGAAGGGTGATACACTGACTGTCAGACAGCTCCTGATTGCCCTTATGCTTCCATCCGGTAA
TGATGCAGCCTATACCCTTGCAGTCAATACTGGAAAGAAGATTGCAGGAGATAAAAGCCTGACCCATCAGCAAGCGATTG
AAGTATTCATGGATAAGGTAAATGAAAAAGCCGTGGACCTTGGCGCCACAAACTCGAAATTTATAGCTCCGGATGGATAT
GATGCCGAAGGGCAGTATACTACAGCTTACGACCTTGCTATCATTGCAAAAGCATGTTTGGACAATCCTATCATTTCGGA
GATTGTAGCGAGTTATTCATCCTATGAAAAATGGCCAAACGGAAGAGAGGTCACTTACAGCAATTCCAATGAGCTTCTCG
ATCCGAACAGTCCCTATTACCGTCCGGAGGTTATCGGCCTGAAAACCGGGACCAGCAGCCTTGGCGGCGCATGTATTGTT
TCTGCAGCGGTGATTGACGGAGAAACCTATATCTGCGTAGTTATGGGCTCTACAAAGGAAAGCAGGTTTCAGGACAGTGT
TGATATTTTAGATAAAATCAAAGCCCAGTAA