MEGAResFrom MEG, the Microbial Ecology Group

VANYD

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanD operon and is an accessory gene.

References

Sequences

Download Sequences

>Gly|AY082011.1|gene5|Glycopeptides|VanD-type_accessory_protein|VANYD
GTGGAACGTCAAAATAACAATGAAAACCAGTATGGAAGGAATCGCAGAAAAGACAAAAGAAAAAAATTGTTTTTTTACAG
AGCAGCATGTGCCATGCTCGGTCTGCTCATAGTCTGTGTAATTTTTGGAGCTGTGTATTTTCTCAGAGAGAGTAAAGATC
CGGTTCTTCCATCCAAAGAAAATACAAAGACAGGCAAGGACTATTCATTTTTGGCCGACGGTCAGAGTGAGGATGAGTCT
CCGATTTCGGAGCCAGCCATATCCAACCGGGCGAATGCGATTGACCTGAACATCATAGCAGCAAATGCCATTGTGATGAA
TAAAGACACCGATGCGTTATTGTATCAAAAAAAACGGCACGGACAGAATTGCGCCGGCCAGTACAGCAAAGATGATTACG
GCGTTGACCGTGCTTGAATATTGTTCTCCGGAGGAGGAGATGAGAGTCGGTGCAGAGATTGAAATGATCCATAGTGATTC
GTCAACCGCATGGCTTATGAAAGGCGATACCCTGACTGTCAGGCAGCTCCTGATTGCCCTGATGCTTCCGTCCGGCAATG
ATGCAGCTTATACCCTTGCAGTCAATACCGGAAAGGTTATTGCAGGCGATAACAGCCTGTCCAATCAGCAGGCCATTCAG
ATATTCATGGATAAGGTAAATGAGAAGGCCAGGGCAATTGGTGTTACAGACTCGAATTTTGTGGTTCCGGATGGGTATGA
TGCCGAGGGGCAGTATACCACGGCCTATGATCTTGCCATCATTGCAAAGGCATGTTTGGAGGATCCCATTATTTCAGAAA
TTGTGGCGAGCAATACGTCGTATGAAAAATGGCCGAACGGCAGGGAGGTCACTTACAACAATTCCAATGAGCTTCTTGAT
CCGAACAGTCCCTATTACCGTCCGGAGGTCATCGGACTGAAAACAGGGACCAGCAGCCTTGGCGGCGCCTGTGTGGTCTC
TGCGGCAGTGATTGACGGAGAAACCTATATTTGCGTAGTCATGGGCTCTACGAAAGAAAGCAGGTTTCAGGACAGCGTTG
CCATTTTGGATAAAATCAAGGCCCAGTGA

>Gly|VanY-D|AB242319|1958-3025|1068|Glycopeptides|VanD-type_accessory_protein|VANYD
GTGGAACGTCAAAATAACAATGAAAACCAGTATGGAAGGAATCGCAGAAAAGACAAAAGAAAAAAATTGTTTTTTTACAG
AGCAGCATGTGCCATGCTCGGTCTGCTCATAGTCTGTGTAATTTTTGGAGCTGTGTATTTTCTCAGAGAGAGTAAAGATC
CGGTTCTTCCATCCAAAGAAAATACAAAGACAGGCAAGGACTATTCATTTTTGGCCGACGGTCAGAGTGAGGATGAGTCT
CCGATTTCGGAGCCAGCCATATCCAACCGGGCGAATGCGATTGACCTGAACATCATAGCAGCAAATGCCATTGTGATGAA
TAAAGACACCGATGCGTTATTGTATCAAAAAAACGGCACGGACAGAATTGCGCCGGCCAGTACAGCAAAGATGATTACGG
CGTTGACCGTGCTTGAATATTGTTCTCCGGAGGAGGAGATGAGAGTCGGTGCAGAGATTGAAATGATCCATAGTGATTCG
TCAACCGCATGGCTTATGAAAGGCGATACCCTGACTGTCAGGCAGCTCCTGATTGCCCTGATGCTTCCGTCCGGCAATGA
TGCAGCTTATACCCTTGCAGTCAATACCGGAAAGGTTATTGCAGGCGATAACAGCCTGTCCAATCAGCAGGCCATTCAGA
TATTCATGGATAAGGTAAATGAGAAGGCCAGGGCAATTGGTGTTACAGACTCGAATTTTGTGGTTCCGGATGGGTATGAT
GCCGAGGGGCAGTATACCACGGCCTATGATCTTGCCATCATTGCAAAGGCATGTTTGGAGGATCCCATTATTTCAGAAAT
TGTGGCGAGCAATACGTCGTATGAAAAATGGCCGAACGGCAGGGAGGTCACTTACAACAATTCCAATGAGCTTCTTGATC
CGAACAGTCCCTATTACCGTCCGGAGGTCATCGGACTGAAAACAGGGACCAGCAGCCTTGGCGGCGCCTGTGTGGTCTCT
GCGGCAGTGATTGACGGAGAAACCTATATTTGCGTAGTCATGGGCTCTACGAAAGAAAGCAGGTTTCAGGACAGCGTTGC
CATTTTGGATAAAATCAAGGCCCAGTGA

>Gly|VanY-D_2_AF175293|Glycopeptides|VanD-type_accessory_protein|VANYD
ATGATGGAATATCAAAACAATAATGGAAACTATGACAAAAGGAATCGTAGAAAAGCCAAAAAAAGAAAATTGCTTTTTTA
CAGGGCTGCATGTGTCATACTTTGTTTGCTCATTGTTTCTGTAATCTTTGGAGTTGTGCATTTTTTAGGGGAGAGTAAAG
ATCCCGGCATTTTATCCAAAGAAAACACAAAAACAGACAAGAACTATTCGTGGCTTACCGACGATCAGAAGGAGGCAGTA
CCCTCAGTTTCAGAGCCAGCCATATCCGACCAGGCTAACAAAATTTCGGTAAATATCACGGCAGCAAACGCCATTGTAAT
GAATAAAGACACAAATGAGGTATTGTACCAGAAAAAAAGCACAGCCCAAATTGCGCCGGCCAGCACTGCTAAGATGATTA
TGGCTTTGACAGCACTTGACTATTGTTCCCCGGAGGATGAAATGAAAGTAGGTGCGGAGATTGAAATGATTCAAAGCGAT
TCGTCAACCGCATGGCTTATGAAGGGTGATACACTGACTGTCAGACAGCTCCTGATTGCCCTTATGCTTCCATCCGGTAA
TGATGCAGCCTATACCCTTGCAGTCAATACTGGAAAGAAGATTGCAGGAGATAAAAGCCTGACCCATCAGCAAGCGATTG
AAGTATTCATGGATAAGGTAAATGAAAAAGCCGTGGACCTTGGCGCCACAAACTCGAAATTTATAGCTCCGGATGGATAT
GATGCCGAAGGGCAGTATACTACAGCTTACGACCTTGCTATCATTGCAAAAGCATGTTTGGACAATCCTATCATTTCGGA
GATTGTAGCGAGTTATTCATCCTATGAAAAATGGCCAAACGGAAGAGAGGTCACTTACAGCAATTCCAATGAGCTTCTCG
ATCCGAACAGTCCCTATTACCGTCCGGAGGTTATCGGCCTGAAAACCGGGACCAGCAGCCTTGGCGGCGCATGTATTGTT
TCTGCAGCGGTGATTGACGGAGAAACCTATATCTGCGTAGTTATGGGCTCTACAAAGGAAAGCAGGTTTCAGGACAGTGT
TGATATTTTAGATAAAATCAAAGCCCAGTAA