MEGAResFrom MEG, the Microbial Ecology Group

VANYB

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanB operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanD-type accessory protein

Sequences

Download Sequences

>>MEG_7598|Drugs|Glycopeptides|VanD-type_accessory_protein|VANYB
atggaaaaaagcaactatcattccaatgcggatcatcacaaacggcatatgaaacaatccgtggaaaagcgggcttttct
atgtgcgttcattatttcgttcacagtctgcacgctgtttttggggtggagactggcttccgtattggaggcaacacaga
taccgcccatccctgcaactcatacaggcagcagcactgacgtagtggagaatttggaggaaaacgctcttgccaccgcc
aaagaacagggagatgaacaggaatggagcctgattttagtgaacaggcagaaccccatccccgcacagtacgatgtgga
gcttgagcaactatcaaatggtgagcggatagatattcggatttctccctatcttcaagatttgtttgatgccgcaagaa
ctgatggagtttacccgattgtcgcatccggataccgaacaacagaaaaacagcaagaaattatggatgaaaaaattgcc
gaatataaggcgaaaggctacacctctgcacaggctaaagcggaagcagaaacttgggtggccgtgccgggaacgagcga
gcatcagcttggtcttgctgtggatatcaatgcggacggaattcattcaacaggcaacgaggtttatagatggctggatg
aaaacagctatcgttttggttttattcgtcgctacccaccagacaagacagagataaccggtgtgagcaacgagccgtgg
cattaccgatatgttggcatcgaagctgccacagagatgtacaaccaaggggtttgccttgaggaatatttaaaaccaga
aaaatga