MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXYC

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanC operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>>MEG_7574|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
atgaatccctatctacagttagttagcaaagaatttccgttagaaaaaaaccaagaaccccctcatttagtccttgctgc
cttcagcgaagacgaggtttacttgcagccagaagcagccaaacaatggaaacggctcgtcaaagccttaaagcttgaaa
acgagatctgcttgttagatggctaccgaaccgaaaagcagcaacggtatttatgggaatattccttgaaagaaaatggg
ctagcctatacgaaacaatttgtggcgttgcccggttgcagtgaacatcagttaggcttagcgatcgatgttggtttaaa
gggcagccaggatgatttgatctgcccacgatttcgtgacagcgcagccgccgatttatttacccaggaaatgatgaact
atgggtttattttacgctatcccgcagacaaacaggagattacagggattggctatgaaccatggcattttcgttatgtc
ggtctgcctcatagtcaaatcatcgccagtcaacagtggaccttggaagaataccatcaataccttgaacaaactgcgag
gcagttcgcatga

>>MEG_7575|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
atgaatccctatctacagttagttagcaaagaatttccgttagaaaaaaaccaagaaccccctcatttagtccttgctgc
cttcagcgaagacgaggtttacttgcagccagaagcagccaaacaatgggaacggctcgtcaaagccttaaagcttgaaa
acgagatctgcttgttagatggctaccgaaccgaaaagcagcaacggtatttatgggaatattccttgaaagaaaatggg
ctagcctatacgaaacaatttgtggcattgcccggttgcagtgaacatcagttaggcttagcgatcgatgttggtttaaa
gggcagccaggatgatttgatctgcccactatttcgtgacagcgcagccgctgatttatttacccaggaaatgatgaact
atgggtttattttacgctatcccgcagacaaacaggagattacagggattggctatgaaccatggcatttccggtatgtc
gggctgcctcatagtcaaatcatcgccagtcaacagtggaccttggaagaataccatcaataccttgaacaaactgcgag
gcagttcgcatga

>>MEG_7576|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
atgaatccctatctacagttagttagcaaagaatttccgttagaaaaaaaccaagaaccccctcatttagtccttgctgc
cttcagcgaagacgatgtttacttgcagccagaagcagccaaacaatggaaacggctcgtcaaagccttaaagcttgaaa
acgagatctgcttgttagatggctaccgaaccgaaaagcagcaacggtatttatgggaatattccttgaaagaaaatggg
ctagcctatacgaaacaatttgtggcattgcccggttgcagtgaacatcagttaggcttagcgatcgatgttggtttaaa
gggcagccaggatgatttgatctgcccacgatttcgtgacagcgcagccgctgatttatttacccaggaaatgatgaact
atgggtttattttacgctatcccgcagacaaacaggagattacagggattggctatgaaccatggcattttcgttatgtc
ggtctgcctcatagtcaaatcatcgccagtcaacagtggaccttggaagaataccatcaataccttgaacaaactgcgag
gcagttcgcatga

>>MEG_7577|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
atgaatccctatctacagttagttagcaaagagtttccattagaaaaaaaccaagagccgccccacctcgtccttgctgc
ttttagtgaagaagaagtttacttgcagcctgaagcagccaaacaatgggaacgcctcgtcaaagccttaaaacttgaaa
acgagatctgcttattagacggctatcgaaccgaaaagcagcaacggcatttatgggaatattccttaaaagaaaatgga
ttagcctatacgaaacaatttgtggcgttgcccggctgcagcgagcatcagttaggcttagcgatcgatgttggtttaaa
aggccagcaaggtgatttgatctgcccacggtttcgtgacagcgcagcggcggatttatttacacaggaaatgatgaact
acggatttattttacgctatcccgcagacaaacaggagattacagggattggctatgaaccatggcattttcgttatgtc
ggtctacctcatagtcaaatcatcgccagtcaacagtggacattggaagaatactatcaatatcttgaacaaaccgcgag
gcagttcgcatga

>>MEG_7578|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGTCCTTGCTGC
CTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGGAACGGCTCGTCAAAGCCTTAAAGCTTGAAA
ACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAAGAAAATGGG
CTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
GGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACAAACTGCGAG
GCAGTTCGCATGA

>>MEG_7579|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAGCCGCCTCATTTAGTCCTTGCTGC
CTTCAGTGAAGACGAGGTTTACTTGCAACCAGAAGCAGCCAAACAATGGAAACGGCTAGTCAAAGCTTTAAAGCTTGAAG
ACGAGATCTGCTTATTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAAGAAAATGGG
CTAGCCTATACGAAACAATTTGTGGCATTGCCCGGGTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
AGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ATGGGTTTATTTTACGCTATCCCGCGGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCCCATAGTCAAATCATCGCCAGCCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACAAACGGCGAG
GCAGTTCGCATGA

>>MEG_7580|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAACCAAGAGCCGCCCCACCTCGTCCTTGCTGC
TTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAAAACTTGAAA
ACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGCATTTATGGGAATATTCCTTAAAAGAAAATGGA
TTAGCCTATACGAAACAATTTGTGGCGTTGCCCGACTGCAGCGAGCATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
AGGCCAGCAAGGTGATTTGATCTGCCCACGGTTTCGTGACAGCGTAGCGGCGGATTTATTTACACAGGAAATGATGAACT
ACGGATTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACATTGGAAGAATACTATCAATACCTTGAACAAACCGCGAG
GCAGTTCGCATGA

>>MEG_7581|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTTACTGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGA

>>MEG_7582|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAACACATTACAATTGATCAATAAAAACCATCCATTGAAAAAAAATCAAGAGCCCCCGCACTTAGTGCTAGCTCCTTT
TAGCGATCACGATGTTTACCTGCAGCCAGAAGTGGCAAAACAATGGGAACGACTCGTACGAGCAACCGGACTAGAAAAGG
ACATTCGTCTGGTAGATGGGTATCGTACGGAAAAAGAACAGCGACGCTTGTGGGAGTATTCTCTAAAAGAAAACGGGTTA
GCTTATACCAAACAATTCGTTGCTTTGCCAGGTTGCAGTGAACATCAAATCGGTCTGGCCATTGATGTAGGACTAAAGAA
ACAAGAAGATGATGATCTTATCTGCCCTCATTTTCGAGATAGTGCTGCTGCTGATTTATTTATGCAGCAGATGATGAATT
ATGGCTTTATTCTACGCTATCCGGAAGATAAACAAGAGATCACCGGTATCAGTTATGAACCTTGGCATTTTCGTTATGTC
GGGCTTCCCCATAGCCAAGTCATCACTGCCCAAAAATGGACTCTGGAAGAATACCATGATTACTTGGCTCAGACAGTGAG
GCAGTTCGCATGA

>>MEG_7583|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAAAAATAAAGGAATCGATCAATTTCGTGTGATTGCAGCCATGATGGTGGTTGCGATCCATTGTCTTCCCCTTCACTA
TTTATGGCCAGAAGGCGATATCCTAATCACATTGACGATTTTTCGAGTAGCTGTTCCTTTCTTTTTTATGATCAGTGGTT
ACTATGTGTTTGCAGAACTTGCTGTGGCCAATAGTTATCCTTCGCGACAACGAGTATTCAACTTTATCAAAAAACAGCTA
AAAGTCTATCTATTAGCCACACTAATGTTTTTACCATTAGCACTCTATAGTCAAACGATCGGCTTCGATCTACCAGTTGG
AACATTAGTACAAGTACTTTTGGTCAATGGCATTCTTTATCATCTTTGGTACTTTCCGGCTTTGATTACTGGGAGCCTGC
TCCTAACAAGTTTGCTGATACATGTCTCCTTCAAAAAAGTGTTCTGGCTTGCGGCTGGATTGTACCTGATTGGATTAGGT
GGTGATAGTTGGTTTGGACTGATCCAACAGACACCAATCGAACCATTCTATACTGCTGTGTTCCACCTATTAGATGGTAC
CCGCAACGGTATTTTCTTTACACCATTGTTTTTGTGCTTAGGTGTGCTGGTCAGAAAACAATCAGAGAAAAGAAGTTTAT
CCAAAACAGCTCTCTTCTTTTTGATCAGTCTTATCGGATTGCTTATTGAGAGTGCGTACTTGCATGGGTTTTCTATACCT
AAACATGACAGTATGTATCTCTTCTTGCCTGTTGTACTCTTTTTCTTATTTCCGCTGATCTTGCGCTGGCATCCCCACAG
GACTTGGAAGCATCCAGGACAGCTATCTTTGTGGCTTTACCTTTTACATCCTTATACAATTGCCGGCACACACTTTTTGA
GCCAAAAAATCAGCATTCTGCAAAACAATCTAATCAACTATTTGGTTGTTTTGATCTTGACGATTGGATTCATTTGCCTC
TTTTTAAGACAAAAACACTCATGGTTTAGACACAAACAAACAACGCCCGTTAAAAGGGCCGTAAAAGAATTCTCAAAGAC
AGCCCTTTTGCATAATCTACAGGAGATCCAGCGGATCATCTCACCGAAAACAAAAGTGATGGCAGTCGTTAAAGCCGATG
CCTACGGCTGTGGTGCCAAGGAAGTTGCTCCTGTTTTAGAACAAGCCGGAATTGATTTTTTTGCGGTGGCTACGATTGAT
GAAGGTATTCGATTGCGGAAAAATGCTGTCAAAAGCCCCATCTTGGTCTTGGGATATACCTCTCCAAAACGCATAAAAGA
ACTTCGTCGCTACTCATTGACCCAATCGATCATCAGCGAAGGTCATGCTGTAGCATTGTCACAAAGAAAAGTAGCGATTG
ACTGTCATTTAGCCATCGATACTGGGATGCATCGGTTAGGTGTAACACCGACTATCGATTCGATTCTTTCGATTTTCGAT
TTGCCCTTCTTGACGATCAGTGGTGTTTATTCTCATCTTGGTTCGGCAGATCGCTTAAATCCTGATAGTATGATTCGCAC
TCAGAAGCAGATTGCCTGCTTCGATCAGATTCTCCTAGAGTTGGATCAGAGACAGATTTCTTATGGTATCACACACTTAC
AAAGCAGTTATGGTATTTTGAATTATCCAGACTTAAACTATGATTATGTGCGTCCGGGGATTTTATTGACAGGATCCCTC
AGTGATACGAACGAGCCTACAAAACAACGAGTAAGCTTACAGCCTATTCTGACCCTCAAAGCACAGTTGATCACTAAGCG
AGTCGTTGCCAAAGGGGAAGCGATCGGTTATGGGCAAACCGCCGTCGCGAATCAAGAAACAACTGTTGGTGTTGTGAGCA
TCGGCTATTGTGACGGACTGCCCCGTTCTCTATCAAATCAAGAGTTTTGTCTTTCCTATCGCGGTCAGTCCTTGCCGCAG
ATCGGCTTGATCTGCATGGACATGCTTTTGATAGACTTGAGCCATTGTCCTACGATCCCAATTGAAAGTGAAATTGAAAT
TCTGACAGATTGGAGCGATACTGCCGAGCAAGTACAAACTATAACCAATGAGTTGATTTGTCGGATCGGTCCACGAGTCA
GTGCTAGGATCAAATAG

>>MEG_7584|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGTCAGAAAAAATAGTCGTTGTTGATGATGAAAAAGAAATTGCGGACTTAGTCACGACCTTTTTGCAAAACGAAGGATT
TAGTGTGCAGCCGTTTTATGATGGTACTAGTGCCATCGCCTATATTGAAAAAGAAGCCATTGATTTGGCCGTTTTAGATG
TCATGTTGCCGGACATTGATGGTTTTCAACTGTTACAGCAGATCCGCAAGACCCATTTTTTCCCAGTGTTGATGCTGACT
GCCAAGGGAGAGGATCTAGACAAAATCACTGGATTGAGTTTGGGAGCGGATGACTATGTCACCAAACCTTTTAATCCTTT
AGAAGTTGTGGCTCGGGTAAAAACCCAATTGCGGCGCTACCAGCGATACAATCATTCCACTGCTTCTCCAACAGTAGAAG
AATATGAAAAAGACGGCTTGATACTCAAAATCAACAGTCATCAATGCATTCTCTACGGCAAAGAAGTTTTCCTGACTCCC
ATTGAGTTCAAAATATTGCTTTATTTATTTGAGCACCAAGGATCCGTCGTCTCTTCCGAAACACTTTTCGAAGCGGTTTG
GAAAGAAAAATATTTAGATAACAATAATACTGTCATGGCACACATTGCTCGTTTAAGAGAAAAATTGCATGAAGAACCTC
GTAAACCTAAATTAATCAAAACCGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>>MEG_7585|Drugs|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAAACAAGAGCCGCCCCACCTAGTCCTTGCTGC
TTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAAAACTTGAAA
ACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTAAAAGAAAATGGA
TTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGCTGTAGCGACCATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
GGGCAGCCAGAATGATTTGATCTGTCCACGTTTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ACGGATTTATTTTACGCTACCCCGCAGACAAACAAGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTTTGCCTCATAGTCAAATCATGGCCAATCAACAGTGGACCTTGGAAGAATACCATCAGTATCTTGAACAGACCACGAG
GCAGTTCGCATGA