MEGAResFrom MEG, the Microbial Ecology Group

VANXYC

The vanXY gene encodes a D,D-dipeptidase/D,D-carboxypeptidase. This gene is part of the VanC operon and is a core resistance gene.

References

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>Gly|VanXY-C_3_EU151752|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAAACAAGAGCCGCCCCACCTAGTCCTTGCTGC
TTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAAAACTTGAAA
ACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTAAAAGAAAATGGA
TTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGCTGTAGCGACCATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
GGGCAGCCAGAATGATTTGATCTGTCCACGTTTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ACGGATTTATTTTACGCTACCCCGCAGACAAACAAGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTTTGCCTCATAGTCAAATCATGGCCAATCAACAGTGGACCTTGGAAGAATACCATCAGTATCTTGAACAGACCACGAG
GCAGTTCGCATGA

>Gly|VanXYc3|AY033764|1075-1647|573|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAGCCGCCTCATTTAGTCCTTGCTGC
CTTCAGTGAAGACGAGGTTTACTTGCAACCAGAAGCAGCCAAACAATGGAAACGGCTAGTCAAAGCTTTAAAGCTTGAAG
ACGAGATCTGCTTATTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAAGAAAATGGG
CTAGCCTATACGAAACAATTTGTGGCATTGCCCGGGTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
AGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ATGGGTTTATTTTACGCTATCCCGCGGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCCCATAGTCAAATCATCGCCAGCCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACAAACGGCGAG
GCAGTTCGCATGA

>CARD|phgb|AF162694|2438-3011|ARO:3002966|vanXYC|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAACACATTACAATTGATCAATAAAAACCATCCATTGAAAAAAAATCAAGAGCCCCCGCACTTAGTGCTAGCTCCTTT
TAGCGATCACGATGTTTACCTGCAGCCAGAAGTGGCAAAACAATGGGAACGACTCGTACGAGCAACCGGACTAGAAAAGG
ACATTCGTCTGGTAGATGGGTATCGTACGGAAAAAGAACAGCGACGCTTGTGGGAGTATTCTCTAAAAGAAAACGGGTTA
GCTTATACCAAACAATTCGTTGCTTTGCCAGGTTGCAGTGAACATCAAATCGGTCTGGCCATTGATGTAGGACTAAAGAA
ACAAGAAGATGATGATCTTATCTGCCCTCATTTTCGAGATAGTGCTGCTGCTGATTTATTTATGCAGCAGATGATGAATT
ATGGCTTTATTCTACGCTATCCGGAAGATAAACAAGAGATCACCGGTATCAGTTATGAACCTTGGCATTTTCGTTATGTC
GGGCTTCCCCATAGCCAAGTCATCACTGCCCAAAAATGGACTCTGGAAGAATACCATGATTACTTGGCTCAGACAGTGAG
GCAGTTCGCATGAA

>Gly|VanXYc4|EU151753|1078-1650|573|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAACCAAGAGCCGCCCCACCTCGTCCTTGCTGC
TTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAAAACTTGAAA
ACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGCATTTATGGGAATATTCCTTAAAAGAAAATGGA
TTAGCCTATACGAAACAATTTGTGGCGTTGCCCGACTGCAGCGAGCATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
AGGCCAGCAAGGTGATTTGATCTGCCCACGGTTTCGTGACAGCGTAGCGGCGGATTTATTTACACAGGAAATGATGAACT
ACGGATTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACATTGGAAGAATACTATCAATACCTTGAACAAACCGCGAG
GCAGTTCGCATGA

>Gly|VanXYc2_c3|EU151760|1078-1650|573|Glycopeptides|VanC-type_resistance_protein|VANXYC
ATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGTCCTTGCTGC
CTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGGAACGGCTCGTCAAAGCCTTAAAGCTTGAAA
ACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAAGAAAATGGG
CTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGTTGGTTTAAA
GGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAATGATGAACT
ATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTTCGTTATGTC
GGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACAAACTGCGAG
GCAGTTCGCATGA