MEGAResFrom MEG, the Microbial Ecology Group

VANTC

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanC operon and is a core resistance gene.

References

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>Gly|VanTc4|EU151753|1647-3749|2103|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAAGGAATTGAGCAGTTTCGGGTGATTTTAGCGATGATGGTGGTGGCGATCCACTGTCTGCCCCTTCA
TCGATTGTGGCCCAATGGTGATATCCTGATCACATTGACTCTTTTCAGAATCGCCGTCCCCTTCTTTTTTATGATCAGCG
GGTATTATGTGTTCAGTGATTTAGCCACCCAAAACAGCTATCCTGCCAGACAACGTATCTGGTTATTTATCAAAAAACAG
CTGCAAGTCTATCTCATTGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATACTAGGATTGAACATGCCACT
AGACACTTTTATTCAAACTTTGCTAGTCAACGGCATTCTTTACCATCTTTGGTATTTTCCTGCGATCATTACCGGCGGTC
TACTAGTGATGGGCCTCTTGACACGGCTTTCTTTCAAGCAGGTGTTTTTCATTGCTGTCGGTTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCACAAACACCCATCACGCCACTCTATTCACTGATTTTCCAACTATTGGATGG
AACTCGCAACGGCATTTTTTTTGCTCCCTTATTTTTGATCTTAGGGGTACTAGCCAGAAGATTTGCCAAAAAACCTGCTT
CTCCCCATCGCTATAGTTATCTGATGATTAGTCTTATTTGCTTGCTTTTGGAAAGTTATCTCTTGCATCACTTTACTACA
CCTAAACATGACAGCATGTATGTCTTTTTGCCCTTCGTTCTCTTGTTTTTATTTCCGATCATTCAGCAATGGCAAGCACC
CATGATCTGGAAACAAGCGGGTCGTCTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCAGTAACCCATTTTC
TTAGTCAAAAGCTACCCTTGCTGCAAAACAATCTGATCAATTTCTTGGTGGTCTTAGGACTGACCATTGGGGTGGTGCAT
GGTCTCTTTGCTTTGCAAAAGCTGTTGCCGTTTCCGAAAAAAACGCCGCTCCACTTGCAGCGGGCAGCCAAAGAATTCTC
AGCCCCCGCCCTGTTGCACAACTTGCAGGAAATCAAACGAGTGATTCCATCCACAACAAAAGTGATGGCGGTGGTTAAAG
CAGATGCCTATGGTTGCGATGCACAATTGGTCGCTCGTACCTTAGAAAGAGTAGGCGTCGATTTTTTTGCTGTTGCCACC
ATAGAAGAAGCCATCGAATTAAGGCGAGCTGGCATTAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAACCGATATTCCTTAATTCAAACTATCGTCAGTGAAGCGCATGGACAAGCGTTAGCCCGAACAGGCCTTC
CAATCGAATGCCATTTAGCGGTAGATACCGGCATGCATCGTCTAGGCGTTGCCCCTGACCTTGAAACAGTTAGAAGGCTT
TATGCCTTGCCATCCCTCAAGATCACAGGCATTTTTTCCCACCTAGGCTCTTCAGATCAGCTAGATACGGCAAGTATCTT
ACGGACGCAAGCCCAAATCATTTGTTTTGATGATCTATTGGCTGGCTTATCCGCTAGAAATATCGCCTATGGTCTGACGC
ATCTGCAAAGCAGCTACGGCATTTTGAATTATCCAGAGAAACACTATGATTATGTGCGCCCGGGTATTCTTTTAACTGGT
TCCCTGAGTGTCCCGAATGAACCAACAAAACAGAAGATAAACGTACAGCCGATTCTGACCCTAAAAGCCTTACTAGTGGA
CAAAAAAACAGTCGCCGCTGGTGAAGCGATCGGCTATGGACTAGCCACTGTTTTTGATCGACCTACCACGATTGGGATCG
TTAGTATCGGCTACTGTGACGGAGTCCCCCGTGCCCTATCAAATCAAGGATTCCAATTGTCTTATCAAGGGGTTTTACTC
CCGCAGGTTGGGTTGATTTGTATGGATATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTGGTT
AGAAGTAATCAGCGATTGGACGAATACAGCTGATCAAGCACAAACCATTCCCAATGAATTGATCAGTCGACTAGGTTCCC
GCGTCCCTTCAATGTCAAAGTAG

>Gly|VanTc|DQ022190|1802-3898|2097|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAAAATAAAGGAATCGATCAATTTCGTGTGATTGCAGCCATGATGGTGGTTGCGATCCATTGTCTTCCCCTTCACTA
TTTATGGCCAGAAGGCGATATCCTAATCACATTGACGATTTTTCGAGTAGCTGTTCCTTTCTTTTTTATGATCAGTGGTT
ACTATGTGTTTGCAGAACTTGCTGTGGCCAATAGTTATCCTTCGCGACAACGAGTATTCAACTTTATCAAAAAACAGCTA
AAAGTCTATCTATTAGCCACACTAATGTTTTTACCATTAGCACTCTACAGTCAAACGATCGGCTTCGATCTACCAGTTGG
AACATTAGTACAATCACTTTTGGTCAATGGCATTCTTTATCATCTTTGGTACTTTCCGGCTTTGATTACTGGGAGCCTGC
TCCTAACAAGTTTGCTGATACATGTCTCCTTCAAAAAAGTGTTCTGGCTTGCGGCTGGATTGTACCTGATTGGATTAGGT
GGTGATAGTTGGTTTGGACTGATCCAACAGACACCAATCGAACCATTCTATACTGCTGTGTTCCACCTATTAGATGGTAC
CCGCAACGGTATTTTCTTTACACCATTGTTTTTGTGCTTAGGTGTGCTGGTCAGAAAACAATCAGTGAAAAGAAGTTTAT
CCAAAACAGCTCTCTTCTTTTTGATCAGTCTTATCGGATTGCTTATTGAGAGTGCGTACTTGCATGGGTTTTCTATACCT
AAACATGACAGTATGTATCTCTTCTTGCCTGTTGTACTCTTTTTCTTATTTCCACTGATCTTGCGCTGGCATCCCCACAG
GACTTGGAAGCATCCGGGACAGCTATCTTTATGGCTTTACCTTTTGCATCCTTATACAATTGCCGGCACACACTTTTTGA
GCCAAAAAATCAGCATTCTGCAAAACAATCTAATCAACTATTTGGTTGTTTTGATCTTGACGATTGGATTCATTTGCCTC
TTTTTAAGACAACAACACTCATGGTTTAGACACAAACAAACAACGCCCGTTAAAAGGGTCGTAAAAGAATTCTCAAAGAC
AGCCCTTTTGCATAATCTACAGGAGATCCAGCGGATCATCTCACCGAAAACAAAAGTGATGGCAGTCGTTAAAGCCGATG
CCTACGGCTGTGGTGCCAAGGAAGTTGCTCCTGTTTTAGAACAAGCCGGAATTGATTTTTTTGCGGTGGCTACGATTGAT
GAAGGTATTCAATTGCGGAAAAATGCTGTCAAAAGCCCCATCTTGGTCTTGGGATATACCTCTCCAAAACGCATAAAAGA
ACTTCGTCGCTACTCATTGACCCAATCGATCATCAGCGAAGGTCATGCTGTAGCATTGTCACAAAGAAAAGTAGCGATTG
ACTGTCATTTAGCCATCGATACTGGGATGCATCGGTTAGGTGTAACACCGACTATCGATTCGATTCTTTCGATTTTCGAT
TTGCCCTTCTTGACGATCAGTGGTGTTTATTCTCATCTTGGTTCGGCAGATCGCTTAAATCCTGATAGTATGATTCGCAC
TCAGAAGCAGATTGCCTGCTTCGATCAGATTCTCCTAGAGCTGGATCAGAGACAGATTTCTTATGGTATCACACACTTAC
AAAGCAGTTATGGTATTTTGAATTATCCAGACTTAAACTATGATTATGTGCGTCCGGGGATTTTATTGACAGGATCCCTC
AGTGATACGAACGAGCCTACAAAACAACGAGTAAGCTTACAGCCTATTCTGACCCTCAAAGCACAGTTGATCACTAAGCG
AGTCGTTGCCAAAGGGGAAGCGATCGGTTATGGGCAAACCGCCGTCGCGAATCAAGAAACAACTGTTGGTGTTGTGAGCA
TCGGCTATTGTGACGGACTGCCCCGTTCTCTATCAAATCAAGAGTTTTGTCTTTCCTATCGCGGTCAGTCCTTGCCGCAG
ATCGGCTTGATCTGCATGGATATGCTTTTGATAGACTTGAGCCATTGTCCTACGATCCCAATTGAAAGTGAAATTGAAAT
TCTGACAGATTGGAGCGATACTGCCGAGCAAGTACAAACTATAACCAATGAGTTGATTTGTCGGATCGGTCCACGAGTCA
GTGCTAGGATCAAATAG

>Gly|VanT|AF162694|3008-5104|2097|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAAAATAAAGGAATCGATCAATTTCGTGTGATTGCAGCCATGATGGTGGTTGCGATCCATTGTCTTCCCCTTCACTA
TTTATGGCCAGAAGGCGATATCCTAATCACATTGACGATTTTTCGAGTAGCTGTTCCTTTCTTTTTTATGATCAGTGGTT
ACTATGTGTTTGCAGAACTTGCTGTGGCCAATAGTTATCCTTCGCGACAACGAGTATTCAACTTTATCAAAAAACAGCTA
AAAGTCTATCTATTAGCCACACTAATGTTTTTACCATTAGCACTCTATAGTCAAACGATCGGCTTCGATCTACCAGTTGG
AACATTAGTACAAGTACTTTTGGTCAATGGCATTCTTTATCATCTTTGGTACTTTCCGGCTTTGATTACTGGGAGCCTGC
TCCTAACAAGTTTGCTGATACATGTCTCCTTCAAAAAAGTGTTCTGGCTTGCGGCTGGATTGTACCTGATTGGATTAGGT
GGTGATAGTTGGTTTGGACTGATCCAACAGACACCAATCGAACCATTCTATACTGCTGTGTTCCACCTATTAGATGGTAC
CCGCAACGGTATTTTCTTTACACCATTGTTTTTGTGCTTAGGTGTGCTGGTCAGAAAACAATCAGAGAAAAGAAGTTTAT
CCAAAACAGCTCTCTTCTTTTTGATCAGTCTTATCGGATTGCTTATTGAGAGTGCGTACTTGCATGGGTTTTCTATACCT
AAACATGACAGTATGTATCTCTTCTTGCCTGTTGTACTCTTTTTCTTATTTCCGCTGATCTTGCGCTGGCATCCCCACAG
GACTTGGAAGCATCCAGGACAGCTATCTTTGTGGCTTTACCTTTTACATCCTTATACAATTGCCGGCACACACTTTTTGA
GCCAAAAAATCAGCATTCTGCAAAACAATCTAATCAACTATTTGGTTGTTTTGATCTTGACGATTGGATTCATTTGCCTC
TTTTTAAGACAAAAACACTCATGGTTTAGACACAAACAAACAACGCCCGTTAAAAGGGCCGTAAAAGAATTCTCAAAGAC
AGCCCTTTTGCATAATCTACAGGAGATCCAGCGGATCATCTCACCGAAAACAAAAGTGATGGCAGTCGTTAAAGCCGATG
CCTACGGCTGTGGTGCCAAGGAAGTTGCTCCTGTTTTAGAACAAGCCGGAATTGATTTTTTTGCGGTGGCTACGATTGAT
GAAGGTATTCGATTGCGGAAAAATGCTGTCAAAAGCCCCATCTTGGTCTTGGGATATACCTCTCCAAAACGCATAAAAGA
ACTTCGTCGCTACTCATTGACCCAATCGATCATCAGCGAAGGTCATGCTGTAGCATTGTCACAAAGAAAAGTAGCGATTG
ACTGTCATTTAGCCATCGATACTGGGATGCATCGGTTAGGTGTAACACCGACTATCGATTCGATTCTTTCGATTTTCGAT
TTGCCCTTCTTGACGATCAGTGGTGTTTATTCTCATCTTGGTTCGGCAGATCGCTTAAATCCTGATAGTATGATTCGCAC
TCAGAAGCAGATTGCCTGCTTCGATCAGATTCTCCTAGAGTTGGATCAGAGACAGATTTCTTATGGTATCACACACTTAC
AAAGCAGTTATGGTATTTTGAATTATCCAGACTTAAACTATGATTATGTGCGTCCGGGGATTTTATTGACAGGATCCCTC
AGTGATACGAACGAGCCTACAAAACAACGAGTAAGCTTACAGCCTATTCTGACCCTCAAAGCACAGTTGATCACTAAGCG
AGTCGTTGCCAAAGGGGAAGCGATCGGTTATGGGCAAACCGCCGTCGCGAATCAAGAAACAACTGTTGGTGTTGTGAGCA
TCGGCTATTGTGACGGACTGCCCCGTTCTCTATCAAATCAAGAGTTTTGTCTTTCCTATCGCGGTCAGTCCTTGCCGCAG
ATCGGCTTGATCTGCATGGACATGCTTTTGATAGACTTGAGCCATTGTCCTACGATCCCAATTGAAAGTGAAATTGAAAT
TCTGACAGATTGGAGCGATACTGCCGAGCAAGTACAAACTATAACCAATGAGTTGATTTGTCGGATCGGTCCACGAGTCA
GTGCTAGGATCAAATAG

>Gly|VanTc3|AY033764|1644-3746|2103|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAAGGAATCGAGCAATTTCGGGTGATTTTGGCGATGATGGTGGTGGCGATCCACTGTCTGCCTCTTCA
TCACTTATGGCCTGACGGTGATACCCTGATCACGTTGACGCTCTTCAGAATTGCCGTTCCCTTCTTTTTTATGATCAGCG
GATATTACGTGTTCAGCGACTTAGCCACCCAAAACAGCTATCCTGCCAGACATCGTGTCTGGCAGTTTATTAAAAAGCAG
CTGCAAGTCTACCTCATAGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATGCTAGGGTTGAACATGCCACT
AGGCACTTTTATTCAAACTTTGCTGGTCAATGGCATCCTTTATCATCTATGGTATTTTCCTGCGATCATTACCGGCAGTC
TATTAGTGATGGGCCTCTTGACACGTCTTTCTTTCAAGCAGGTGTTTTTCACTGCTGTCGGCTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCCCAAACACCCATCACGCCACTCTATTCACGGATTTTTCAACTATTGGATGG
AACTCGCAACGGCATTTTCTTTGCTCCTTTGTTTTTGATCTTAGGGGTACTAGCCAGAAGATTTGCCAAGAAACCAGCTT
CTCCCCATCGCTATAGTTATCTGCTGATCAGTCTGATTTGCTTGCTTTTGGAAAGTTACCTTTTGCATCACTTTACCACG
CCGAAACATGACAGCATGTATATTTTTTTGCCCTTCGTCCTGTTGTTTTTATTTCCGATCATCCAGCAATGGCAAGCACC
CATAATCTGGAAACAAGCGGGTCGACTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCAGTGACCCATTTTC
TTAGTCAAAAACTGCCCTTGCTGCAAAACAATCTGATCAATTTCTTCGTGGTCTTAGGACTGACCATTGGGGTGGTGCAT
GGTCTCTTTGCTTTGCAAAAGCTGTTCCCGTTTCCGAAAAAAACGCCGCCCCACTTGCAGCGAGCAACCAAAGAATTTTC
CGCCCCCGCTTTGTTGCACAACCTGCAGGAAATCAAGCGATTGATCCCAGCAACAACTAAAGTGATGGCGGTGGTTAAAG
CGGATGCTTATGGTTGTGATGCGAAGACGGTCGCCAGTACCCTAGAAAGAGCCGGCGTCGATTTCTTTGCCGTTGCTACC
CTTGAAGAAGCCATTGAATTACGGCGAGCTGGCATCAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAAACATTATTCCTTGATTCAAACCATCGTTAGTGAGGCCCATGGGCATGCTTTAGCCCAAACAAGCATTC
CGATCGAATGCCATTTAGCGGTAGATACTGGTATGCACCGCTTAGGCGTTGCACCTGATCTTGAGACAGTTACTGGACTT
TACGCCTTGCCATCTCTCAAGATCACACGCATTTTTTCCCATCTAGGCTCTTCAGATCAGCTGGATACGGCAAGTATCTT
GCGGACACAAGCCCAAATCACTTGTTTTGATGATCTGTTGGCTGGCTTATCCGCTAGAAATATCGCCTATGGACTGACAC
ATCTGCAAAGCAGCTACGGAATATTGAATTACCCAGAGAAACACTATGATTATGTACGTCCAGGTATTCTTCTAACTGGT
TCATTGAGCGTCCCGAACGAACCAACGAAGCAGAAGATAAACGTACAACCAATTTTGACACTCAAAGCCTTACTGGTAGA
CAAAAAAACAGTTGCCGCTGGTGAAGCGATCGGCTATGGATTAGGCACTGTTTTTGATCGACCAGCCACGATTGGGATCG
TTAGCATCGGCTACTGCGACGGGGTTCCACGTGCCCTATCAAACCAAGGGTTCCAACTTTCTTATCAGGGTGCTTTACTC
CCGCAGATTGGGTTGGTTTGTATGGATATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTCGCT
CGAAGTAATCAGCGATTGGACGACTACCGCTTATCAAGCACAAACCATTACCAATGAATTGATCAGCCGCCTAGGTTCCC
GCATCACCTCTAGTTCAAAGTAG

>Gly|VanT-C_2_EU151752|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAGGGAATCGATCAGTTTCGGGTGATTCTAGCGATGATGGTGGTGGCGATCCACTGTCTGCCCCTTCA
TCGATTGTGGCCCGATGGTGATATCCTGATCACATTGACGCTTTTCAGAATCGCCGTCCCCTTCTTTTTTATGATCAGCG
GATATTACGTGTTCAGCGACTTGGCCACCCAAAACAGCTATCCTGCCAGACAGCGTGTCTGGCATTTTATTAAAAAGCAG
CTACAAGTCTATCTCATAGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATGTTAGGATTGAACATGCCCCT
AGGCACTTTTATTCAAACTTTGCTAGTCAATGGCATCCTTTATCATCTATGGTATTTTCCTGCGATCATTACCGGCAGTC
TTTTAGTGATGGGCCTCTTGACACGTCTTTCTTTCAAGCAGGTGTTTTTCATTGCTGTCGGTTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCCCAAACACCCCTCGCGTCACTCTATTCACTGATTTTCCAACTATTGGCTGG
AACTCGCAACGGCATTTTCTTTGCTCCCTTGTTTTTGCTCTTAGGGGTACTAGCCAGAAGATTTGCCCAAAAACCTGCTT
CTCCCCATCGCTATAGTTATCTAATGATTAGTCTGATTTGCTTGCTTTTGGAAAGTTACCTTTTGCATCACTTTACCACG
CCGAAACATGACAGCATGTATGTTTTTTTGCCCTTCGTCCTATTGTTTTTATTTCCGATCATCCAGCAATGGCAAGCACC
CATGATCTGGAAACAAGCGGGTCGACTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCGGTGACCCATTTTC
TTAGTCAGAAACTGCCCTTGCTGCAAAACAATTTGATCAATTACATTGTGGTCTTAGGGCTGACCATCGGGTTGATTTAT
GGTCTCTTTGCTTTGCAAAAGCTGTTCTCGTTTCCGAAAAAAACGCCGCCCCACTTGCAACGGGCAACCAAAGAATTTTC
AGCCCCCGCCTTGCTGCACAACTTGCAGGAAATCAAACGAGTGATTCCATCCACAACAAAAGTGATGGCGGTGGTTAAAG
CGGATGCCTATGGTTGTGATGCGAAGACGGTCGCAGGCACCCTAGAAAGAGCCGGCGTCGATTTCTTTGCCGTTGCTACC
ATTGAAGAAGCCATTGAATTGCGGCGAGCTGGCATCAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAACCGATATTCTTTAATTCAAACCGTCGTTAGTGAAGCACATGGACAAGCGTTAGCCCGAACAGGCCTTC
CAATCGAGTGCCATTTAGCGGTAGATACCGGTATGCATCGTCTGGGTGTTGCCCCTGACCTCGAAACAGTTAGAAAGCTT
TTCGCCTTGCCATCCCTCAAGATCACAGGCATTTTTTCCCATCTAGGCTCTTCAGATCAGCTAGATACGGCAAGTATCTT
GCGGACACAAGCCCAAATCACTTGTTTTGATGATCTATTGGCTGGTTTGTCTGCTAGAAATATCGCCTACGGTCTGACGC
ATCTGCAAAGCAGCTACGGAATATTGAATTACCCAGAGAAACACTATGATTATGTGCGCCCAGGTATTCTTCTAACTGGT
TCATTGAGCGTCCCGAACGAACCAACGAAGCAGAAGATAAACGTACAGCCGATTTTGACACTCAAAGCCTTACTGGTAGA
CAAAAAAACAGTTGCAGCCGGAGAAGCGATCGGCTATGGACTAGGCACTGTTTTTGATCGACCAGCCACGATCGGGATCG
TTAGTATCGGCTACTGCGACGGGGTCCCCCGTGCCCTATCAAATCAAGGATTCCAATTGTCTTATCAAGGGGTTTTACTC
CCGCAGATTGGGTTGGTTTGTATGGACATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTCGCT
CGAAGTAATCAGCGATTGGACGACTGCAGCTGATCAAGCACAAACCATTACCAATGAATTGATCAGCCGCCTAGGTTCCC
GCATCACCTCTAGTGCAAAGTAG