MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANTC

The vanT gene encodes a serine/alanine racemase. This gene is part of the VanC operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>>MEG_7524|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
atgaagaagaatcaaggaatcgagcaattccgggtgattttggcgatgatggtggtggcgatccactgtctgcctcttca
ccgcttatggcctgacggtgatatcctgatcacgttgacgctcttcagaattgccgtccccttcttttttatgatcagcg
gatattacgtgttcagcgacttagccacccaaaacagctatcctgccagacagcgtgtctggcagtttattaaaaagcag
ctgcaagtctacctcatagccacactgctctttttgccgcttgcttggtacagcggcatgcttgggttgaacatgccgct
gggcacctttatccaaacattgttggtcactggcattctttaccatctttggtattttcctgcgatcattaccggcagtc
tactagtgatgggcctcttgacacggctttctttcaagcaggtgtttttcattgctgtcggtttgtatgtggttggttta
ggtggggacagttggtctggcctggctgcacaaacacccattacgccactctattcactgatttttcaactattggatgg
aactcgcaacggcattttctttgctcctttgtttttgatcttaggggtactagcctctcaggggtaccagccaggaagat
ttgccaagaaaccagcttctccccatcgctatagttatctgctgatcagtctgatttgcttgcttttggaaagttacctt
ttgcatcactttaccacgccgaaacatgacagcatgtatgtttttttgcccttcgtcctgttgtttttatttccgatcat
ccagcaatggcaagcacccataatctggaaacaagcgggtcgactgtccctttggctctatttgctccatccttatacca
ttgcagtgacccattttcttagtcaaaagctacccttgctgcaaaacaatctgatcaatttcttggtggtcttaggactg
accattggggtggtgcatggtctctttgctttgcaaaagctgttcccgttttcgaaaaaaacgccgcttcacttgcagcg
agcagccaaagaattttccgcccccgctttgttgcacaacttgcaggaaatcaagcgattgatcccagcaacaacaaaag
tgatggcggtggttaaagcggatgcttatggttgtgatgcgaagacggttgccggtaccctagaaagagccggcgtcgat
ttctttgccgttgctacccttgaagaagccattgaattacggcgagcaggcatcaaaagtcgcttactgattttagggta
cacttctgcccaacatgccaaagagatgaaacattattccttgattcaaaccatcgttagtgaggcccatgggcatgctt
tagcccaaacaagcataccgatcgaatgccatttagcagtagatactggtatgcaccgcttaggcgttgcacctgatctt
gaggcagttactggactttacgccttgccatctctcaagatcacacgcattttttcccatctaggctcttcagatcagct
ggatacggcaagtatcttgcggacacaagcccaaatcacttgttttgatgatctgttggctggcttatccgctagaaata
tcgtctatggactgacacatctgcaaagcagctacggaatattgaattacccagagaaacactatgattatgtacgtcca
ggtattcttctaactggttcattgagcgtcccgaacgaaccaacgaagcagaagataaacgtacaaccgattttgacact
caaagccttactggtagacaaaaaaacagttgccgctggtgaagcgatcggctatggattaggcactatttttgatcgac
cagccacgatcgggatcgttagcatcggctactgcgacggggttccacgtgccctatcaaaccaagggttccaactttct
tatcaaggtgctttactcccgcagattgggttggtttgtatggatatgctcttgatcgatttaacggactatccagaact
ggcggtcgaaagttcgctcgaagtaatcagcgattggacgactaccgctgatcaagcacaaaccattaccaatgaattga
tcagccgcctaggttcccgcatcacctctagttcaaagtag

>>MEG_7525|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
atgattaggaataaatcttatgcagggcttgattattttaggattatagctgcattacttataattgcaattcatacatc
tccattattatcatatagtaaaatggctgactttgtgttaactagtataattgctcgtattgctgtgccattctttttta
tgctatcaggcttttttctaatttcaacatataattataattgtaataaactgaaatcttttctaaaaaatgtattattt
atttacgggatagctattgtaatttatattcccttaaatatttacactggatatttttccatgaataatttagtgcccaa
tattattaaggacattgtatttgatgggactttatatcatttatggtatctacctgcatcaattattggtgcaagtattg
catactttcttgtaaaaaaactaggtttaaagtactcattagtaatcactattgttatttatgtaattggtatgtttggt
gatagttattatggttttttagaaaaaataccactattaaagaatttatatgggtatatttttgaagtatcagattatac
acgaaatggtatattttttgcacctgtatttttcatacttggtggaataatatctaataaatctaattatatgtcaacta
aaaatagcttgattggatttcttatatcattcttacttatgttatgtgagggaatgtttttacataaactaggggtacag
cgtcatgatagcatgtatattatgttattgccatgtatgtatttcttatttacagccttaacatttttgaaaggttctcg
agctaggttattgcgaacatcatcattaattatttatattatacatcctatgatgattgttgttattcgtatgttttcta
aaatattcggaatacaaactgtcttggttgacaatagccttattcattatatagtggtaagtatagcatcttttatagct
tctataattattatattgattcttaaacctctaaaaaaagacttgaaaggagaacataaggtaaataccaatagagcttg
gattgaaattgatttaaataatttggaacataatgtaaagatgatacaaaaagctatgccagaagattgtgaattgatgg
cagttgtaaaagctaatgcctatggtcatagtgcttttgaagtagcgacttgtgcaaaccaaataggtgtaaaagcattt
gcagtagcaacaatagatgaggggattgatttacgtcgatatggaatactaggagaaatattgattcttggatatactaa
cccaataagggcaaaggaacttcataaatacaatcttacacagagtgttattgaccttaatcatgctatctctttaaaca
aacagaaatacaacataaaatcacacattaaaattgatacaggtatgcacagactgggttttgatgttaatgatgtgagg
tcaattttaaaggcatttaaattaaaatacttagatatatgtggaatatttacacacttgtgtgtttcagatagtctgaa
agatgaagatgtagactttacaaataaacaaattgaatgtttttataagttaattgattttctgttaaaaaaaggtataa
aaattcctaaagtacatattcaaagtagttatggtttttttaattatcccaatcttaagtgtaattatgtaagaattgga
attgcattatacgggatattaagttctccaaatgatacgactaaattgcaacttgatttacgacctgttttatccttaaa
atcacaagtaattcttattagaaaaatacaaaaagatgatagttttggatatggaagagtttttattgcaagcagagata
gcgtaattgctatattatctattggctatgccgatggtatacctagaaatttatcctgtggaaaaagttacgtaataata
aatggttgtagagcagcaatagtgggtcgaatttgcatggaccaacttgctgttgatattacagatatacctaatgtaga
agttggtaatacggcaataataataggaagagataatttagctgaattatctgcttctgaagttgcaaataactcatgta
gtatatcgaatgaattattgagcagagtaggaagaaggttaaatgttataaagaagtaa

>>MEG_7526|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAAAATAAAGGAATCGATCAATTTCGTGTGATTGCAGCCATGATGGTGGTTGCGATCCATTGTCTTCCCCTTCACTA
TTTATGGCCAGAAGGCGATATCCTAATCACATTGACGATTTTTCGAGTAGCTGTTCCTTTCTTTTTTATGATCAGTGGTT
ACTATGTGTTTGCAGAACTTGCTGTGGCCAATAGTTATCCTTCGCGACAACGAGTATTCAACTTTATCAAAAAACAGCTA
AAAGTCTATCTATTAGCCACACTAATGTTTTTACCATTAGCACTCTACAGTCAAACGATCGGCTTCGATCTACCAGTTGG
AACATTAGTACAATCACTTTTGGTCAATGGCATTCTTTATCATCTTTGGTACTTTCCGGCTTTGATTACTGGGAGCCTGC
TCCTAACAAGTTTGCTGATACATGTCTCCTTCAAAAAAGTGTTCTGGCTTGCGGCTGGATTGTACCTGATTGGATTAGGT
GGTGATAGTTGGTTTGGACTGATCCAACAGACACCAATCGAACCATTCTATACTGCTGTGTTCCACCTATTAGATGGTAC
CCGCAACGGTATTTTCTTTACACCATTGTTTTTGTGCTTAGGTGTGCTGGTCAGAAAACAATCAGTGAAAAGAAGTTTAT
CCAAAACAGCTCTCTTCTTTTTGATCAGTCTTATCGGATTGCTTATTGAGAGTGCGTACTTGCATGGGTTTTCTATACCT
AAACATGACAGTATGTATCTCTTCTTGCCTGTTGTACTCTTTTTCTTATTTCCACTGATCTTGCGCTGGCATCCCCACAG
GACTTGGAAGCATCCGGGACAGCTATCTTTATGGCTTTACCTTTTGCATCCTTATACAATTGCCGGCACACACTTTTTGA
GCCAAAAAATCAGCATTCTGCAAAACAATCTAATCAACTATTTGGTTGTTTTGATCTTGACGATTGGATTCATTTGCCTC
TTTTTAAGACAACAACACTCATGGTTTAGACACAAACAAACAACGCCCGTTAAAAGGGTCGTAAAAGAATTCTCAAAGAC
AGCCCTTTTGCATAATCTACAGGAGATCCAGCGGATCATCTCACCGAAAACAAAAGTGATGGCAGTCGTTAAAGCCGATG
CCTACGGCTGTGGTGCCAAGGAAGTTGCTCCTGTTTTAGAACAAGCCGGAATTGATTTTTTTGCGGTGGCTACGATTGAT
GAAGGTATTCAATTGCGGAAAAATGCTGTCAAAAGCCCCATCTTGGTCTTGGGATATACCTCTCCAAAACGCATAAAAGA
ACTTCGTCGCTACTCATTGACCCAATCGATCATCAGCGAAGGTCATGCTGTAGCATTGTCACAAAGAAAAGTAGCGATTG
ACTGTCATTTAGCCATCGATACTGGGATGCATCGGTTAGGTGTAACACCGACTATCGATTCGATTCTTTCGATTTTCGAT
TTGCCCTTCTTGACGATCAGTGGTGTTTATTCTCATCTTGGTTCGGCAGATCGCTTAAATCCTGATAGTATGATTCGCAC
TCAGAAGCAGATTGCCTGCTTCGATCAGATTCTCCTAGAGCTGGATCAGAGACAGATTTCTTATGGTATCACACACTTAC
AAAGCAGTTATGGTATTTTGAATTATCCAGACTTAAACTATGATTATGTGCGTCCGGGGATTTTATTGACAGGATCCCTC
AGTGATACGAACGAGCCTACAAAACAACGAGTAAGCTTACAGCCTATTCTGACCCTCAAAGCACAGTTGATCACTAAGCG
AGTCGTTGCCAAAGGGGAAGCGATCGGTTATGGGCAAACCGCCGTCGCGAATCAAGAAACAACTGTTGGTGTTGTGAGCA
TCGGCTATTGTGACGGACTGCCCCGTTCTCTATCAAATCAAGAGTTTTGTCTTTCCTATCGCGGTCAGTCCTTGCCGCAG
ATCGGCTTGATCTGCATGGATATGCTTTTGATAGACTTGAGCCATTGTCCTACGATCCCAATTGAAAGTGAAATTGAAAT
TCTGACAGATTGGAGCGATACTGCCGAGCAAGTACAAACTATAACCAATGAGTTGATTTGTCGGATCGGTCCACGAGTCA
GTGCTAGGATCAAATAG

>>MEG_7527|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAAGGAATCGAGCAATTTCGGGTGATTTTGGCGATGATGGTGGTGGCGATCCACTGTCTGCCTCTTCA
TCACTTATGGCCTGACGGTGATACCCTGATCACGTTGACGCTCTTCAGAATTGCCGTTCCCTTCTTTTTTATGATCAGCG
GATATTACGTGTTCAGCGACTTAGCCACCCAAAACAGCTATCCTGCCAGACATCGTGTCTGGCAGTTTATTAAAAAGCAG
CTGCAAGTCTACCTCATAGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATGCTAGGGTTGAACATGCCACT
AGGCACTTTTATTCAAACTTTGCTGGTCAATGGCATCCTTTATCATCTATGGTATTTTCCTGCGATCATTACCGGCAGTC
TATTAGTGATGGGCCTCTTGACACGTCTTTCTTTCAAGCAGGTGTTTTTCACTGCTGTCGGCTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCCCAAACACCCATCACGCCACTCTATTCACGGATTTTTCAACTATTGGATGG
AACTCGCAACGGCATTTTCTTTGCTCCTTTGTTTTTGATCTTAGGGGTACTAGCCAGAAGATTTGCCAAGAAACCAGCTT
CTCCCCATCGCTATAGTTATCTGCTGATCAGTCTGATTTGCTTGCTTTTGGAAAGTTACCTTTTGCATCACTTTACCACG
CCGAAACATGACAGCATGTATATTTTTTTGCCCTTCGTCCTGTTGTTTTTATTTCCGATCATCCAGCAATGGCAAGCACC
CATAATCTGGAAACAAGCGGGTCGACTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCAGTGACCCATTTTC
TTAGTCAAAAACTGCCCTTGCTGCAAAACAATCTGATCAATTTCTTCGTGGTCTTAGGACTGACCATTGGGGTGGTGCAT
GGTCTCTTTGCTTTGCAAAAGCTGTTCCCGTTTCCGAAAAAAACGCCGCCCCACTTGCAGCGAGCAACCAAAGAATTTTC
CGCCCCCGCTTTGTTGCACAACCTGCAGGAAATCAAGCGATTGATCCCAGCAACAACTAAAGTGATGGCGGTGGTTAAAG
CGGATGCTTATGGTTGTGATGCGAAGACGGTCGCCAGTACCCTAGAAAGAGCCGGCGTCGATTTCTTTGCCGTTGCTACC
CTTGAAGAAGCCATTGAATTACGGCGAGCTGGCATCAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAAACATTATTCCTTGATTCAAACCATCGTTAGTGAGGCCCATGGGCATGCTTTAGCCCAAACAAGCATTC
CGATCGAATGCCATTTAGCGGTAGATACTGGTATGCACCGCTTAGGCGTTGCACCTGATCTTGAGACAGTTACTGGACTT
TACGCCTTGCCATCTCTCAAGATCACACGCATTTTTTCCCATCTAGGCTCTTCAGATCAGCTGGATACGGCAAGTATCTT
GCGGACACAAGCCCAAATCACTTGTTTTGATGATCTGTTGGCTGGCTTATCCGCTAGAAATATCGCCTATGGACTGACAC
ATCTGCAAAGCAGCTACGGAATATTGAATTACCCAGAGAAACACTATGATTATGTACGTCCAGGTATTCTTCTAACTGGT
TCATTGAGCGTCCCGAACGAACCAACGAAGCAGAAGATAAACGTACAACCAATTTTGACACTCAAAGCCTTACTGGTAGA
CAAAAAAACAGTTGCCGCTGGTGAAGCGATCGGCTATGGATTAGGCACTGTTTTTGATCGACCAGCCACGATTGGGATCG
TTAGCATCGGCTACTGCGACGGGGTTCCACGTGCCCTATCAAACCAAGGGTTCCAACTTTCTTATCAGGGTGCTTTACTC
CCGCAGATTGGGTTGGTTTGTATGGATATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTCGCT
CGAAGTAATCAGCGATTGGACGACTACCGCTTATCAAGCACAAACCATTACCAATGAATTGATCAGCCGCCTAGGTTCCC
GCATCACCTCTAGTTCAAAGTAG

>>MEG_7528|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAAGGAATTGAGCAGTTTCGGGTGATTTTAGCGATGATGGTGGTGGCGATCCACTGTCTGCCCCTTCA
TCGATTGTGGCCCAATGGTGATATCCTGATCACATTGACTCTTTTCAGAATCGCCGTCCCCTTCTTTTTTATGATCAGCG
GGTATTATGTGTTCAGTGATTTAGCCACCCAAAACAGCTATCCTGCCAGACAACGTATCTGGTTATTTATCAAAAAACAG
CTGCAAGTCTATCTCATTGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATACTAGGATTGAACATGCCACT
AGACACTTTTATTCAAACTTTGCTAGTCAACGGCATTCTTTACCATCTTTGGTATTTTCCTGCGATCATTACCGGCGGTC
TACTAGTGATGGGCCTCTTGACACGGCTTTCTTTCAAGCAGGTGTTTTTCATTGCTGTCGGTTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCACAAACACCCATCACGCCACTCTATTCACTGATTTTCCAACTATTGGATGG
AACTCGCAACGGCATTTTTTTTGCTCCCTTATTTTTGATCTTAGGGGTACTAGCCAGAAGATTTGCCAAAAAACCTGCTT
CTCCCCATCGCTATAGTTATCTGATGATTAGTCTTATTTGCTTGCTTTTGGAAAGTTATCTCTTGCATCACTTTACTACA
CCTAAACATGACAGCATGTATGTCTTTTTGCCCTTCGTTCTCTTGTTTTTATTTCCGATCATTCAGCAATGGCAAGCACC
CATGATCTGGAAACAAGCGGGTCGTCTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCAGTAACCCATTTTC
TTAGTCAAAAGCTACCCTTGCTGCAAAACAATCTGATCAATTTCTTGGTGGTCTTAGGACTGACCATTGGGGTGGTGCAT
GGTCTCTTTGCTTTGCAAAAGCTGTTGCCGTTTCCGAAAAAAACGCCGCTCCACTTGCAGCGGGCAGCCAAAGAATTCTC
AGCCCCCGCCCTGTTGCACAACTTGCAGGAAATCAAACGAGTGATTCCATCCACAACAAAAGTGATGGCGGTGGTTAAAG
CAGATGCCTATGGTTGCGATGCACAATTGGTCGCTCGTACCTTAGAAAGAGTAGGCGTCGATTTTTTTGCTGTTGCCACC
ATAGAAGAAGCCATCGAATTAAGGCGAGCTGGCATTAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAACCGATATTCCTTAATTCAAACTATCGTCAGTGAAGCGCATGGACAAGCGTTAGCCCGAACAGGCCTTC
CAATCGAATGCCATTTAGCGGTAGATACCGGCATGCATCGTCTAGGCGTTGCCCCTGACCTTGAAACAGTTAGAAGGCTT
TATGCCTTGCCATCCCTCAAGATCACAGGCATTTTTTCCCACCTAGGCTCTTCAGATCAGCTAGATACGGCAAGTATCTT
ACGGACGCAAGCCCAAATCATTTGTTTTGATGATCTATTGGCTGGCTTATCCGCTAGAAATATCGCCTATGGTCTGACGC
ATCTGCAAAGCAGCTACGGCATTTTGAATTATCCAGAGAAACACTATGATTATGTGCGCCCGGGTATTCTTTTAACTGGT
TCCCTGAGTGTCCCGAATGAACCAACAAAACAGAAGATAAACGTACAGCCGATTCTGACCCTAAAAGCCTTACTAGTGGA
CAAAAAAACAGTCGCCGCTGGTGAAGCGATCGGCTATGGACTAGCCACTGTTTTTGATCGACCTACCACGATTGGGATCG
TTAGTATCGGCTACTGTGACGGAGTCCCCCGTGCCCTATCAAATCAAGGATTCCAATTGTCTTATCAAGGGGTTTTACTC
CCGCAGGTTGGGTTGATTTGTATGGATATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTGGTT
AGAAGTAATCAGCGATTGGACGAATACAGCTGATCAAGCACAAACCATTCCCAATGAATTGATCAGTCGACTAGGTTCCC
GCGTCCCTTCAATGTCAAAGTAG

>>MEG_7529|Drugs|Glycopeptides|VanC-type_resistance_protein|VANTC
ATGAAGAAGAATCAGGGAATCGATCAGTTTCGGGTGATTCTAGCGATGATGGTGGTGGCGATCCACTGTCTGCCCCTTCA
TCGATTGTGGCCCGATGGTGATATCCTGATCACATTGACGCTTTTCAGAATCGCCGTCCCCTTCTTTTTTATGATCAGCG
GATATTACGTGTTCAGCGACTTGGCCACCCAAAACAGCTATCCTGCCAGACAGCGTGTCTGGCATTTTATTAAAAAGCAG
CTACAAGTCTATCTCATAGCCACACTGCTCTTTTTGCCGCTTGCTTGGTACAGCGGCATGTTAGGATTGAACATGCCCCT
AGGCACTTTTATTCAAACTTTGCTAGTCAATGGCATCCTTTATCATCTATGGTATTTTCCTGCGATCATTACCGGCAGTC
TTTTAGTGATGGGCCTCTTGACACGTCTTTCTTTCAAGCAGGTGTTTTTCATTGCTGTCGGTTTGTATGTGGTTGGTTTA
GGTGGGGACAGTTGGTCTGGCCTGGCTGCCCAAACACCCCTCGCGTCACTCTATTCACTGATTTTCCAACTATTGGCTGG
AACTCGCAACGGCATTTTCTTTGCTCCCTTGTTTTTGCTCTTAGGGGTACTAGCCAGAAGATTTGCCCAAAAACCTGCTT
CTCCCCATCGCTATAGTTATCTAATGATTAGTCTGATTTGCTTGCTTTTGGAAAGTTACCTTTTGCATCACTTTACCACG
CCGAAACATGACAGCATGTATGTTTTTTTGCCCTTCGTCCTATTGTTTTTATTTCCGATCATCCAGCAATGGCAAGCACC
CATGATCTGGAAACAAGCGGGTCGACTGTCCCTTTGGCTCTATTTGCTCCATCCTTATACCATTGCGGTGACCCATTTTC
TTAGTCAGAAACTGCCCTTGCTGCAAAACAATTTGATCAATTACATTGTGGTCTTAGGGCTGACCATCGGGTTGATTTAT
GGTCTCTTTGCTTTGCAAAAGCTGTTCTCGTTTCCGAAAAAAACGCCGCCCCACTTGCAACGGGCAACCAAAGAATTTTC
AGCCCCCGCCTTGCTGCACAACTTGCAGGAAATCAAACGAGTGATTCCATCCACAACAAAAGTGATGGCGGTGGTTAAAG
CGGATGCCTATGGTTGTGATGCGAAGACGGTCGCAGGCACCCTAGAAAGAGCCGGCGTCGATTTCTTTGCCGTTGCTACC
ATTGAAGAAGCCATTGAATTGCGGCGAGCTGGCATCAAAAGTCGCTTACTGATTTTAGGGTACACTTCTGCCCAACGTGC
CAAAGAGCTGAACCGATATTCTTTAATTCAAACCGTCGTTAGTGAAGCACATGGACAAGCGTTAGCCCGAACAGGCCTTC
CAATCGAGTGCCATTTAGCGGTAGATACCGGTATGCATCGTCTGGGTGTTGCCCCTGACCTCGAAACAGTTAGAAAGCTT
TTCGCCTTGCCATCCCTCAAGATCACAGGCATTTTTTCCCATCTAGGCTCTTCAGATCAGCTAGATACGGCAAGTATCTT
GCGGACACAAGCCCAAATCACTTGTTTTGATGATCTATTGGCTGGTTTGTCTGCTAGAAATATCGCCTACGGTCTGACGC
ATCTGCAAAGCAGCTACGGAATATTGAATTACCCAGAGAAACACTATGATTATGTGCGCCCAGGTATTCTTCTAACTGGT
TCATTGAGCGTCCCGAACGAACCAACGAAGCAGAAGATAAACGTACAGCCGATTTTGACACTCAAAGCCTTACTGGTAGA
CAAAAAAACAGTTGCAGCCGGAGAAGCGATCGGCTATGGACTAGGCACTGTTTTTGATCGACCAGCCACGATCGGGATCG
TTAGTATCGGCTACTGCGACGGGGTCCCCCGTGCCCTATCAAATCAAGGATTCCAATTGTCTTATCAAGGGGTTTTACTC
CCGCAGATTGGGTTGGTTTGTATGGACATGCTCTTGATCGATTTAACGGACTATCCAGAACTGGCGGTCGAAAGTTCGCT
CGAAGTAATCAGCGATTGGACGACTGCAGCTGATCAAGCACAAACCATTACCAATGAATTGATCAGCCGCCTAGGTTCCC
GCATCACCTCTAGTGCAAAGTAG