MEGAResFrom MEG, the Microbial Ecology Group

VANC

The vanC gene encodes a D-ala-D-ser ligase. This gene is part of the VanC operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>>MEG_7356|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaatcgccattatttttggaggcaattcaccggaatacaccgtttctttagcctcagcaactagcgcaatcga
agcactccaatcatctccctatgactatgacctctctttgatcgggatcgccccagatgctatggattggtacttgtata
caggagaactggaaaacatccgacaagacacgtggttgttggatacgaaacataaacagaaaatccagccgctattcgaa
ggaaacggcttttggctaagtgaagagcagcaaacgttggtacctgatgttttatttcccattatgcatggcaaatatgg
ggaagatggcagtatccaaggattgtttgaattgatgaagctgccttatgtaggttgcggggtggcaggttctgccttat
gtatgaacaaatggctgctgcatcaagctgcagcagccattggcgtacaaagtgctcctacgattctcttgacaaatcaa
gccaaccagcaagaacaaatcgaagcttttatccagacccatggctttccagttttctttaagcctaatgaagcgggctc
ctcaaaagggatcactaaagtcacctgcgttgaagaaatcgcttctgccttaaaagaagcctttacttattgttccgcag
tgctcctacaaaaaaatattgtcggtgttgagatcggttgcggtattttgggcaacgactctttgactgtcggtgcttgt
gacgccatttcattagtagacggctttttcgattttgaagaaaagtaccagctgatcagcgccaaaatcaccgtccctgc
gccattgcctgaaacgattgaaaccaaggtcaaagaacaagctcagctgctctatcgtagtcttggtcttaaaggtcttg
ctcgcatcgacttttttgtcacggatcaaggagaactatacttgaatgaaatcaatactatgccgggctttacgagtcac
tcccgctatcctgccatgatggcagcggtcggcttatcctatcaagaactactacaaaaactgcttgtcttagcaaagga
ggaagtcaaatga

>>MEG_7357|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaatcgccattatttttggaggcaattcaccggaatacaccgtttctttagcttcagcaactagcgcaatcga
agcactccaatcatctccctatgactacgacctctctttgatcgggatcaccccagatgctatggattggtacttgtata
caggagaactggaaaacatccgacaagacacgtggttgttggatacgaaacataaacagaaaatacagccgctattcgaa
ggaaacggcttttggctaagtgaagagcagcaaacgttggtacctgatgttttatttcccattatgcatggcaaatatgg
ggaagatggcagtatccaaggattgtttgaattgatgaagctgccttatgtaggttgcggggtggcaggttctgccttat
gtatgaacaaatggctgctgcatcaagctgcagcagccattggcgtacaaagtgctcctacgattctcttgacaaatcaa
gccaaccagcaagaacaaatcgaagcttttatccagacccatggctttccagttttctttaagcctaatgaagcgggctc
ctcaaaagggatcactaaagtcacctgcgttgaagaaatcgcttctgccttaaaagaagcctttacttattgttccgcag
tgctcctacaaaaaaatattgccggtgttgagatcggttgcggtattttgggcaacgactctttgactgtcggtgcttgt
gacgccatttcattagtagacggctttttcgattttgaagaaaagtaccagctgatcagcgccaaaatcaccgtccctgc
gccattgcctgaaacgattgaaaccaaggtcaaagaacaagctcagctgctctatcgtagtcttggtcttaaaggtcttg
ctcgcatcgacttttttgtcacggatcaaggagaactatacttgaatgaaatcaatactatgccgggctttacgagtcac
tcccgctatcctgccatgatggcagcggtcggcttatcctatcaagaactactacaaaaactgcttgtcttagcaaagga
ggaagtcaaatga

>>MEG_7358|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaatcgccattatttttggaggcaattcaccggaatacaccgtttctttagcttcagcaactagcgcaatcga
agcactccaatcatctccctatgactacgacctctctttgatcgggatcgccccagatgctatggattggtacttgtata
caggagaactggaaaacatccgacaagacacgtggttgttggatacgaaacataaacagaaaatccagccgctattcgaa
ggaaacggcttttggctaagtgaagagcagcaaacgttggtacctgatgttttatttcccattatgcatggcaaatatgg
ggaagatggcagtatccaaggattgtttgaattgatgaagctgccttatgtaggttgcggggtggcaggttctgccttat
gtatgaacaaatggctgctgcatcaagctgcagcagccattggcgtacaaagtgctcctacgattctcttgacaaatcaa
gccaaccagcaagaacaaatcgaagcttttatccagacccatggcttcccagttttctttaagcctaatgaagcgggctc
ctcaaaagggatcactaaagtcacctgcgttgaagaaatcgcttctgccttaaaagaagcctttacttattgttccgcag
tgctcctacaaaaaaatattgccggtgttgagatcggttgcggtattttgggcaacgactctttgactgtcggtgcttgt
gacgccatttcattagtagacggctttttcgattttgaagaaaagtaccagctgatcagcgccaaaatcaccgtccctgc
gccattgcctgaaacgattgaaaccaaggtcaaagaacaagctcagctgctctatcgtagtcttggtcttaaaggtcttg
ctcgcatcgacttttttgtcacggatcaaggagaactatacttgaatgaaatcaatactatgccgggctttacgagtcac
tcccgctatcctgccatgatggcagcggtcggcttatcctatcaagaactactacaaaaactgcttgtcttagcaaagga
ggaagtcaaatga

>>MEG_7359|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaatcgccattatttttggaggcaattcatcggaatacaccgtttctttagcctcagcaactagcgcaatcga
agcactccaatcatctccctatgattacgacctctctttgatcgggatcgccccagatgctatggattggtatttgtaca
caggagaactagaaaacatccgacaagacacatggttgttggatacgaaacatacacagaaaatccagccactttttgaa
gaaaacggcttttggctaagtgaagcgcagcaaacgttggtacctgatgttttatttcccattatgcatggcaaatacgg
ggaagatggcagtatccaaggattgtttgaattgatgaagcttccttatgtaggctgcggggtggcagcctctgccttat
gtatgaacaaatggctgctgcatcaagctgcagcagcgattggagtacaaagcgcccctacgattctcttgacaaatcaa
gacaaccaacagcaacaaatcgaagccttcatccagacccatggctttccagttttctttaagcctaatgaagcgggctc
ctcaaaagggatcacaaaagtaacttgtgttgaagaaatcgctcctgccttgaaggaagcattcgcttattgttccgcag
tgctcttacaaaaaaatatcgctggcgttgagattggttgcggtatcttaggcaacgactctttgactgtcggtgcttgt
gacgctatttcattagtagaaggctttttcgattttgaagaaaagtaccaattgattagcgccaagatcaccgttcctgc
accattgcctgaaacgattgaaaccaaggtcaaagaacaagctcagctgctctatcacagtcttggtcttaaaggacttg
ctcgcatcgacttttttgtcacggatcaaggagaactatacttgaatgaaatcaatactatgccgggctttactagtcac
tcccgctatcctgccatgatggcagcaatcggcttatcctatcaagaactactacaaaaactgcttgtcttagcaaagga
ggaaggcaaatga

>>MEG_7360|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaattgccgttttatttggagggaattctccagaatactcagtgtcactaacctcagcagaaagtgtgatcca
agctattaacccgctgaaatatgaagtaatgaccattggcatcgcaccaacaatggattggtattggtatcaaggaaacc
tcgcgaatgttcgcaatgatacttggctagaagatcacaaaaactgtcaccagctgactttttctagccaaggatttata
ttaggagaaaaacgaatcgtccctgatgtcctctttccagtcttgcatgggaagtatggcgaggatggctgtatccaagg
actgcttgaactaatgaacctgccttatgttggttgccatgtcgctgcctccgcattatgtatgaacaaatggctcttgc
atcaacttgctgataccatgggaatcgctagtgctcccactttgcttttatcccgctatgaaaacgatcctgccacaatc
gatcgttttattcaagaccatggattcccgatctttatcaagccgaatgaagccggttcttcaaaagggatcacaaaagt
aactgacaaaacagcgctccaatctgcattaacgactgcttttgcttacggttctactgtgttgatccaaaaggcgatag
cgggtattgaaattggctgcggcatcttaggaaatgagcaattgacgattggtgcttgtgatgcgatttctcttgtcgac
ggtttttttgattttgaagagaaataccaattaatcagcgccacgatcactgtcccagcaccattgcctctcgcgcttga
atcacagatcaaggagcaggcacagctgctttatcgaaacttgggattgacgggtctggctcgaatcgattttttcgtca
ccaatcaaggagcgatttatttaaacgaaatcaacaccatgccgggatttactgggcactcccgctacccagctatgatg
gcggaagtcgggttatcctacgaaatattagtagagcaattgattgcactggcagaggaggacaaacgatga

>>MEG_7361|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaattgccgttttatttggagggaattctccagaatactcagtgtcactagcctcagcagcaagtgtgatcca
agctattgacccgctgaaatatgaagtaatgaccatcggcatcgcaccaacaatggattggtattggtatcaaggaaacc
tcgcgaatgttcgcaatgatacttggctagaagatcacaaaaactgtcaccagctgactttttctagccaaggatttata
ttaggagaaaaacgaatcgtccctgatgtcctctttccagtcttgcatgggaagtatggcgaggatggctgtatccaagg
actgcttgaactaatgaacctgccttatgttggttgccatgtcgctgcctccgcattatgtatgaacaaatggctcttgc
atcaacttgctgataccatgggaatcgctagtgctcccactttgcttttatcccgctatgaaaacgatcctgccacaatc
gatcgttttattcaagaccatggattcccgatctttatcaagccgaatgaagccggttcttcaaaagggatcacaaaagt
aactgacaaaacagcgctccaatctgcattaacgactgcttttgcttacggttctactgtgttgatccaaaaggcgatag
cgggtattgaaattggctgcggcatcttaggaaatgagcaattgacgattggtgcttgtgatgcgatttctcttgtcgac
ggtttttttgattttgaagagaaataccaattaatcagcgccacgatcactgtcccagcaccattgcctctcgcgcttga
atcacagatcaaggagcaggcacagctgctttatcgaaacttggggttgacgggtctggctcgaatcgattttttcgtca
ccaatcaaggagcgatttatttaaacgaaatcaacaccatgccgggatttactgggcactcccgctacccagctatgatg
gcggaagtcgggttatcctacgaaatattagtagagcaattgattgcactggcagaggaggacaaacgatga

>>MEG_7362|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
atgaaaaaaattgccgttttatttggagggaattctccagaatactcagtgtcactagcctcagcagcaagtgtgatcca
agctattgacccgctgaaatatgaagtaatgaccattggcatcgcaccaacaatggattggtattggtatcaaggaaacc
tcgcgaatgttcgcaatgatacttggctagaagatcacaaaaactgtcaccagctgactttttctagccaaggatttata
ttaggagaaaaacgaatcgtccctgatgtcctctttccagtcttgcatgggaagtatggcgaggatggctgtatccaagg
actgcttgaactaatgaacctgccttatgttggttgccatgtcgctgccaccgcattatgtatgaacaaatggctcttgc
atcaacttgctgataccatgggaatcgctagtgctcccactttgcttttatcccgctatgaaaacgatcctgccacaatc
gatcgttttattcaagaccatggattcccgatctttatcaagccgaatgaagccggttcttcaaaagggatcacaaaagt
aactgacaaaacagcgctccaatctgcattaacgactgcttttgcttacggttctactgtgttgatccaaaaggcgatag
cgggtattgaaattggctgcggcatcttaggaaatgagcaattgacgattggtgcttgtgatgcgatttctcttgtcgac
ggtttttttgattttgaagagaaataccaattaatcagcgccacgatcactgtcccagcaccattgcctctcgcgcttga
atcacagatcaaggagcaggcacagctgctttatcgaaacttggggttgacgggtctggctcgaatcgattttttcgtca
ccaatcaaggagcgatttatttaaacgaaatcaacaccatgccgggatttactgggcactcccgctacccagctatgatg
gcggaagtcgggttatcctacgaaatattagtagagcaattgattgcactggcagaggaggacaaacgatga

>>MEG_7363|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTTACTGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGAAATTGATTGCACTGGCAGAGGAGGACAAACGATGA

>>MEG_7364|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGAGCGAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>>MEG_7365|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCAATCATTTTTGGAGGCAATTCACCAGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATAAAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAATTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>>MEG_7366|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACAGAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGTTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTACCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGTTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAC
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGTTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACTAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGACTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGGTTATCCTATCAAGAACTACTACAAAAACTACTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>>MEG_7367|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATCCAGCCACTTTTTGAA
GGAAACGGCTTTTGGATAAGTGAAGCGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGTAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGTGGGGTGGCAGCCTCTGCCTTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGCAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACAAAAGTAACTTGTGTTGAAGAAATCGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCCGCAG
TGCTCTTACAAAAAAATATCGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATCAGCGCCAAAATCACCGTTCCTGC
GCCATTGCCTGAAACGATTGAAACCAAAGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAATTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGA

>>MEG_7368|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAGTACGCCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTATTTGTACA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGCTGTTGGATACGAAACATAAACAGAAAATCCAGCCGCTTTTTGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAACAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAACTACCTTATGTAGGCTGCGGTGTGGCGGCCTCCGCATTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGAAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GACAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGACTTTCCGGTTTTCTTTAAGCCTAATGAAGCTGGCTC
CTCAAAAGGGATCACAAAAGTGACTTGTGTCGAAGAAATTGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCAGCAG
TGCTCTTACAAAAAAATATAGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGAAGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATTAGCGCCAAGATCACCGTTCCTGC
ACCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACTAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCAATCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGA

>>MEG_7369|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTATGACCTCTCTTTGATCGGGATCACCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGTCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACACCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>>MEG_7370|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAGCCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCGCCAACAATGGATTGGTATTTGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATTCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGGTTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATCTATTTAAACGAAATCAACACCATGCCGGGATTTACCGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGA

>>MEG_7371|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAGTACGCCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTATTTGTACA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGCTGTTGGATACGAAACATAAACAGAAAATCCAGCCGCTTTTTGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAACAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAACTACCTTATGTAGGCTGCGGTGTGGCGGCCTCCGCATTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGAAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GACAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGACTTTCCGGTTTTCTTTAAGCCTAATGAAGCTGGCTC
CTCAAAAGGGATCACAAAAGTGACTTGTGTCGAAGAAATTGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCAGCAG
TGCTCTTACAAAAAAATATAGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGAAGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATTAGCGCCAAGATCACCGTTCCTGC
ACCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACTAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCAATCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAACCAAGAGCCGCCCCACCTCGT
CCTTGCTGCTTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAA
AACTTGAAAACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGCATTTATGGGAATATTCCTTAAAA
GAAAATGGATTAGCCTATACGAAACAATTTGTGGCGTTGCCCGACTGCAGCGAGCATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAAGGCCAGCAAGGTGATTTGATCTGCCCACGGTTTCGTGACAGCGTAGCGGCGGATTTATTTACACAGGAAA
TGATGAACTACGGATTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACATTGGAAGAATACTATCAATACCTTGAACA
AACCGCGAGGCAGTTCGCATGA

>>MEG_7372|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCATCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTATTTGTACA
CAGGAGAACTAGAAAACATCCGACAAGACACATGGTTGTTGGATACGAAACATACACAGAAAATCCAGCCACTTTTTGAA
GAAAACGGCTTTTGGCTAAGTGAAGCGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTTCCTTATGTAGGCTGCGGGGTGGCAGCCTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCGATTGGAGTACAAAGCGCCCCTACGATTCTCTTGACAAATCAA
GACAACCAACAGCAACAAATCGAAGCCTTCATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACAAAAGTAACTTGTGTTGAAGAAATCGCTCCTGCCTTGAAGGAAGCATTCGCTTATTGTTCCGCAG
TGCTCTTACAAAAAAATATCGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGAAGGCTTTTTCGATTTTGAAGAAAAGTACCAATTGATTAGCGCCAAGATCACCGTTCCTGC
ACCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACTAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCAATCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAACCAAGAGCCGCCCCACCTCGT
CCTTGCTGCTTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAA
AACTTGAAAACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGCATTTATGGGAATATTCCTTAAAA
GAAAATGGATTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGCTGCAGCGAGCATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAAGGCCAGCAAGGTGATTTGATCTGCCCACGGTTTCGTGACAGCGCAGCGGCGGATTTATTTACACAGGAAA
TGATGAACTACGGATTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTACCTCATAGTCAAATCATCGCCAGTCAACAGTGGACATTGGAAGAATACTATCAATATCTTGAACA
AACCGCGAGGCAGTTCGCATGA

>>MEG_7373|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTTACTGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGAACACATTA
CAATTGATCAATAAAAACCATCCATTGAAAAAAAATCAAGAGCCCCCGCACTTAGTGCTAGCTCCTTTTAGCGATCACGA
TGTTTACCTGCAGCCAGAAGTGGCAAAACAATGGGAACGACTCGTACGAGCAACCGGACTAGAAAAGGACATTCGTCTGG
TAGATGGGTATCGTACGGAAAAAGAACAGCGACGCTTGTGGGAGTATTCTCTAAAAGAAAACGGGTTAGCTTATACCAAA
CAATTCGTTGCTTTGCCAGGTTGCAGTGAACATCAAATCGGTCTGGCCATTGATGTAGGACTAAAGAAACAAGAAGATGA
TGATCTTATCTGCCCTCATTTTCGAGATAGTGCTGCTGCTGATTTATTTATGCAGCAGATGATGAATTATGGCTTTATTC
TACGCTATCCGGAAGATAAACAAGAGATCACCGGTATCAGTTATGAACCTTGGCATTTTCGTTATGTCGGGCTTCCCCAT
AGCCAAGTCATCACTGCCCAAAAATGGACTCTGGAAGAATACCATGATTACTTGGCTCAGACAGTGAGGCAGTTCGCATG
A

>>MEG_7374|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAGCCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCGCCAACAATGGATTGGTATTTGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATTCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGGTTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATCTATTTAAACGAAATCAACACCATGCCGGGATTTACCGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGAACACATTA
CAATTGATCAATAAAAACCATCCATTGAAAAAAAATCAAGAGCCCCCGCACTTAGTGCTAGCTCCTTTTAGCGATCACGA
TGTTTACCTGCAGCCAGAAGTGGCAAAACAATGGGAACGACTCGTACGAGCAACCGGACTAGAAAAGGACATTCGTCTGG
TAGATGGGTATCGTACGGAAAAAGAACAGCGACGCTTGTGGGAGTATTCTCTAAAAGAAAACGGGTTAGCTTATACCAAA
CAATTCGTTGCTTTGCCAGGTTGCAGTGAACATCAAATCGGTCTGGCCATTGATGTAGGACTAAAGAAACAAGAAGATGA
TGATCTTATCTGCCCTCATTTTCGAGATAGTGCTGCTGCTGATTTATTTATGCAGCAGATGATGAATTATGGCTTTATTC
TACGCTATCCGGAAGATAAACAAGAGATCACCGGTATCAGTTATGAACCTTGGCATTTTCGTTATGTCGGGCTTCCCCAT
AGCCAAGTCATCACTGCCCAAAAATGGACTCTGGAAGAATACCATGATTACTTGGCTCAGACAGTGAGGCAGTTCGCATG
A

>>MEG_7375|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCAATCATTTTTGGAGGCAATTCACCAGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATAAAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAATTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGT
CCTTGCTGCCTTCAGCGAAGACGATGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGAAACGGCTCGTCAAAGCCTTAA
AGCTTGAAAACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCATTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACTGCGAGGCAGTTCGCATGA

>>MEG_7376|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTATGACCTCTCTTTGATCGGGATCACCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGTCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACACCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGT
CCTTGCTGCCTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGGAACGGCTCGTCAAAGCCTTAA
AGCTTGAAAACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACTGCGAGGCAGTTCGCATGA

>>MEG_7377|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATCCAGCCACTTTTTGAA
GGAAACGGCTTTTGGATAAGTGAAGCGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGTAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGTGGGGTGGCAGCCTCTGCCTTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGCAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACAAAAGTAACTTGTGTTGAAGAAATCGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCCGCAG
TGCTCTTACAAAAAAATATCGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATCAGCGCCAAAATCACCGTTCCTGC
GCCATTGCCTGAAACGATTGAAACCAAAGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAATTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAGTTTCCATTAGAAAAAAAACAAGAGCCGCCCCACCTAGT
CCTTGCTGCTTTTAGTGAAGAAGAAGTTTACTTGCAGCCTGAAGCAGCCAAACAATGGGAACGCCTCGTCAAAGCCTTAA
AACTTGAAAACGAGATCTGCTTATTAGACGGCTATCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTAAAA
GAAAATGGATTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGCTGTAGCGACCATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGAATGATTTGATCTGTCCACGTTTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTACGGATTTATTTTACGCTACCCCGCAGACAAACAAGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTTTGCCTCATAGTCAAATCATGGCCAATCAACAGTGGACCTTGGAAGAATACCATCAGTATCTTGAACA
GACCACGAGGCAGTTCGCATGA

>>MEG_7378|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACAGAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAAGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGTCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGAAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTATCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGT
CCTTGCTGCCTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGAAACGGCTCGTCAAAGCCTTAA
AGCTTGAAAACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCCGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAGATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACTGCGAGGCAGTTCGCATGA

>>MEG_7379|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACAGAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGTTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTACCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGTTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAC
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGTTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACTAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGACTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGGTTATCCTATCAAGAACTACTACAAAAACTACTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAGCCGCCTCATTTAGT
CCTTGCTGCCTTCAGTGAAGACGAGGTTTACTTGCAACCAGAAGCAGCCAAACAATGGAAACGGCTAGTCAAAGCTTTAA
AGCTTGAAGACGAGATCTGCTTATTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCATTGCCCGGGTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAAGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCGGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCCCATAGTCAAATCATCGCCAGCCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACGGCGAGGCAGTTCGCATGA

>>MEG_7380|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACAGAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGTTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTACCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGTTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAC
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGTTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACTAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGACTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGGTTATCCTATCAAGAACTACTACAAAAACTACTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAGCCGCCTCATTTAGT
CCTTGCTGCCTTCAGTGAAGACGAGGTTTACTTGCAACCAGAAGCAGCCAAACAATGGAAACGGCTAGTCAAAGCTTTAA
AGCTTGAAGACGAGATCTGCTTATTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCATTGCCCGGGTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAAGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCGGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCCCATAGTCAAATCATCGCCAGCCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACGGCGAGGCAGTTCGCATGA

>>MEG_7381|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATCCAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATATGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGTTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGT
CCTTGCTGCCTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGGAACGGCTCGTCAAAGCCTTAA
AGCTTGAAAACGAGATCTGCTTGTTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACTGCGAGGCAGTTCGCATGA

>>MEG_7382|Drugs|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACGCCGTTTCTTTAGCTTCAGCAACTAGCGCACTCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTTGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATATGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGTTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTCACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGAATCCCTATCTACAGTTAGTTAGCAAAGAATTTCCGTTAGAAAAAAACCAAGAACCCCCTCATTTAGT
CCTTGCTGCCTTCAGCGAAGACGAGGTTTACTTGCAGCCAGAAGCAGCCAAACAATGGGAACGGCTCGTCAAAGCTTTAA
AGCTTGAAAACGAGATCTGCTTATTAGATGGCTACCGAACCGAAAAGCAGCAACGGTATTTATGGGAATATTCCTTGAAA
GAAAATGGGCTAGCCTATACGAAACAATTTGTGGCGTTGCCCGGTTGCAGTGAACATCAGTTAGGCTTAGCGATCGATGT
TGGTTTAAAGGGCAGCCAGGATGATTTGATCTGCCCACGATTTCGTGACAGCGCAGCCGCTGATTTATTTACCCAGGAAA
TGATGAACTATGGGTTTATTTTACGCTATCCCGCAGACAAACAGGAAATTACAGGGATTGGCTATGAACCATGGCATTTT
CGTTATGTCGGTCTGCCTCATAGTCAAATCATCGCCAGTCAACAGTGGACCTTGGAAGAATACCATCAATACCTTGAACA
AACTGCGAGGCAGTTCGCATGA