MEGAResFrom MEG, the Microbial Ecology Group

VANC

The vanC gene encodes a D-ala-D-ser ligase. This gene is part of the VanC operon and is a core resistance gene.

References

Other Groups in VanC-type resistance protein

Sequences

Download Sequences

>Gly|VanC3|AY033764|26-1078|1053|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACAGAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGTTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTACCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGTTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAC
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGTTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACTAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGACTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGGTTATCCTATCAAGAACTACTACAAAAACTACTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>Gly|VanC|AF162694|1411-2442|1032|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTTACTGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGA

>Gly|VanC2|L29638|33-1085|1053|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCTTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGAGCGAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>Gly|VanC4|EU151752|29-1081|1053|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATCCAGCCACTTTTTGAA
GGAAACGGCTTTTGGATAAGTGAAGCGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGTAAATACGG
GGAAGATGGCAGTATCCAAGGAATGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGTGGGGTGGCAGCCTCTGCCTTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGCAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACAAAAGTAACTTGTGTTGAAGAAATCGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCCGCAG
TGCTCTTACAAAAAAATATCGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATCAGCGCCAAAATCACCGTTCCTGC
GCCATTGCCTGAAACGATTGAAACCAAAGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAATTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGA

>Gly|VanC1|EU151769|31-1062|1032|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTTACTGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGAAATTGATTGCACTGGCAGAGGAGGACAAACGATGA

>Gly|VanA-C_5_EU151754|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTATGACCTCTCTTTGATCGGGATCACCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATAAACAGAAAATACAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTTCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGTCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACACCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>Gly|VanC2-3|EU151755|29-1081|1083|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCAATCATTTTTGGAGGCAATTCACCAGAATACACCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGACTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTACTTGTATA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGTTGTTGGATACGAAACATACACAGAAAATAAAGCCGCTATTCGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAGCAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAGCTGCCTTATGTAGGCTGCGGGGTGGCAGGTTCTGCCTTAT
GTATGAACAAATGGCTGCTGCATCAAGCTGCAGCAGCCATTGGCGTACAAAGTGCTCCTACGATTCTCTTGACAAATCAA
GCCAACCAGCAAGAACAAATCGAAGCTTTTATCCAGACCCATGGCTTCCCAGTTTTCTTTAAGCCTAATGAAGCGGGCTC
CTCAAAAGGGATCACTAAAGTCACCTGCGTTGAAGAAATCGCTTCTGCCTTAAAAGAAGCCTTTACTTATTGTTCCGCAG
TGCTCCTACAAAAAAATATTGCCGGTGTTGAGATCGGTTGCGGTATTTTGGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCCATTTCATTAGTAGACGGCTTTTTCGATTTTGAAGAAAAGTACCAGCTGATCAGCGCCAAAATCACCGTCCCTGC
GCCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCGTAGTCTTGGTCTTAAAGGTCTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACGAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCGGTCGGCTTATCCTATCAAGAACTACTACAAAAATTGCTTGTCTTAGCAAAGGA
GGAAGTCAAATGA

>Gly|VanA-C_4_EU151753|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATCGCCATTATTTTTGGAGGCAATTCACCGGAGTACGCCGTTTCTTTAGCCTCAGCAACTAGCGCAATCGA
AGCACTCCAATCATCTCCCTATGATTACGACCTCTCTTTGATCGGGATCGCCCCAGATGCTATGGATTGGTATTTGTACA
CAGGAGAACTGGAAAACATCCGACAAGACACGTGGCTGTTGGATACGAAACATAAACAGAAAATCCAGCCGCTTTTTGAA
GGAAACGGCTTTTGGCTAAGTGAAGAGCAACAAACGTTGGTACCTGATGTTTTATTTCCCATTATGCATGGCAAATACGG
GGAAGATGGCAGTATCCAAGGATTGTTTGAATTGATGAAACTACCTTATGTAGGCTGCGGTGTGGCGGCCTCCGCATTAT
GTATGAACAAATGGTTATTGCATCAAGCAGCAGAAGCGATTGGCGTACAAAGCGCTCCTACGATTCTCTTGACAAATCAA
GACAACCAGCAAAGACAAATCGAAGCCTTTATCCAGACCCATGACTTTCCGGTTTTCTTTAAGCCTAATGAAGCTGGCTC
CTCAAAAGGGATCACAAAAGTGACTTGTGTCGAAGAAATTGCTCCTGCCTTGAAGGAAGCCTTCGCTTATTGTTCAGCAG
TGCTCTTACAAAAAAATATAGCTGGCGTTGAGATTGGTTGCGGTATCTTAGGCAACGACTCTTTGACTGTCGGTGCTTGT
GACGCTATTTCATTAGTAGAAGGCTTTTTCGATTTTGAAGAAAAGTACCAGTTGATTAGCGCCAAGATCACCGTTCCTGC
ACCATTGCCTGAAACGATTGAAACCAAGGTCAAAGAACAAGCTCAGCTGCTCTATCACAGTCTTGGTCTTAAAGGACTTG
CTCGCATCGACTTTTTTGTCACGGATCAAGGAGAACTATACTTGAATGAAATCAATACTATGCCGGGCTTTACTAGTCAC
TCCCGCTATCCTGCCATGATGGCAGCAATCGGCTTATCCTATCAAGAACTACTACAAAAACTGCTTGTCTTAGCAAAGGA
GGAAGGCAAATGA

>868|DQ022190.1|DQ022190|Glycopeptides|VanC-type_resistance_protein|VANC
ATGAAAAAAATTGCCGTTTTATTTGGAGGGAATTCTCCAGAATACTCAGTGTCACTAGCCTCAGCAGCAAGTGTGATCCA
AGCTATTGACCCGCTGAAATATGAAGTAATGACCATTGGCATCGCGCCAACAATGGATTGGTATTTGTATCAAGGAAACC
TCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCACCAGCTGACTTTTTCTAGCCAAGGATTTATA
TTAGGAGAAAAACGAATCGTCCCTGATGTCCTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATTCAAGG
ACTGCTTGAACTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAATGGCTCTTGC
ATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTATCCCGCTATGAAAACGATCCTGCCACAATC
GATCGTTTTATTCAAGACCATGGATTCCCGATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGT
AACTGACAAAACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAAAAGGCGATAG
CGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATTGGTGCTTGTGATGCGATTTCTCTTGTCGAC
GGTTTTTTTGATTTTGAAGAGAAATACCAATTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGA
ATCACAGATCAAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGGTTGACGGGTCTGGCTCGAATCGATTTTTTCGTCA
CCAATCAAGGAGCGATCTATTTAAACGAAATCAACACCATGCCGGGATTTACCGGGCACTCCCGCTACCCAGCTATGATG
GCGGAAGTCGGGTTATCCTACGAAATATTAGTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGA