MEGAResFrom MEG, the Microbial Ecology Group

VANSC

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanC operon and is a regulator gene.

References

Other Groups in VanC-type regulator

Sequences

Download Sequences

>Gly|VanS-C_1_AF162694|Glycopeptides|VanC-type_regulator|VANSC
TTGAAAAATAGAAATCCTTTGATCCGAAAGCTCTTGACCCAATACTTCGTCACCACTGGAATCTTGCTGGCATTCCTTGT
AATGATTCCATTAGTCATTCGCTTTATTGCCGGAACCCGGACTTGGTATGGAACGGAACCTATCTACTATATCTTACGTT
TTTTTGCGGATCGCTGGTTGTTTTGTGTTGCGATTGGCGCTTTACTGATATGGTTTGGTACCACCATTTACTATATGACC
AAAGCCATCGGTTATTTGAATGAAACGATCCAAGCCACGACTCAACTGATAGAAGAACCATCCAAACGCATCACTTTATC
GAGCCATCTGATTGATGTTCAAGAGGAAATGAATCAACTGCGGGAGAAAAGTCTGCAAGATCAACGTGCCGCTAAAGAAG
CGGAACAGCGGAAAAATGATTTGATCGTTTATCTCGCCCACGATTTGCGGACGCCTCTGACAAGTGTCATAGGTTATCTG
ACTCTTCTAAAAGAAGAACCACAATTATCCAATGCGATGCGGAATCGTTACACGGAGATTGCTTTACAAAAAGCCCAACG
GCTGGAACTATTGATCAGTGAATTCTTCGAGATCACACGCTTCAATTTGACCACGATCGTTTTGCAGACAGAAACGACTG
ATTTAAGTTTAATGCTTGAACAGCTGACCTTTGAGTTTTTACCTCTCTTGGAAGAAAAGAATCTAAATTGGCAACTCAAC
TTACAAAAAAATGTTCTTGCAACAGTAGACACCGAAAAAATAGCTCGTGTCTTTGATAATCTCATTCGCAATGCCATCAA
CTACAGCTATCCAGATTCGCCTTTACTTCTTGAATTGGTCGAATCAGACAGTATTCACATTCGTCTGACGAATCGTGGAA
AAACAATTCCAGAAGAGATGATCGGACGTCTCTTTGAACCTTTCTATCGCATGGATTCTTCCCGAGCTACAGCCACAAGC
GGAACTGGTCTTGGTCTTCCGATTGCAAAAGAGATTCTGTTAGCATCTGGCGGGGATATCTCGGCAGAAAGCAAAGACGA
AACCATCATTTTCAACGTTCGCTTGCCAAAACCTGCCAACAACTGA

>Gly|VanSc4|EU151753|4599-5663|1065|Glycopeptides|VanC-type_regulator|VANSC
ATGCTCCTTTTGATTCTGATCCCTTTAACTGTTCGCTTTGTAGCAGGATTGAGGGTTTGGTACGGCTATGAGCCCATTTA
TCAAATATTACGGCTTTTTGCTGATTATTGGCTCGTCTGTCTAGCGATCGGTGCCTTGCTGATTTGGGTGAGCACAACGA
TTTATTATATGAGTAAAGCCATCAGCTATTTGAATGAAACGATTCAAGCCACGAATCAATTGATTGCTGAACCTACGAAG
CGAATCGTTCTTTCCAGCAATCTGATCGACGTGCAAGAAGAAATGAACCAGTTGCGGGAAAAAAATCTACAGGATCAACG
AGCTGCCAAAGAAGCAGAGCAGCGGAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGCACACCTTTGACCAGTG
TGATCGGCTATTTGACACTTCTAGAAGAAGAACCGCAGCTTTCTTCCGAACTACGCGCACGCTATACCAAGATCGCCTTG
CAAAAAGCCCAGCGGCTAGAATTATTGATCAGCGAATTTTTCGAAATCACTCGTTTTAATCTTACAACGATCGCCTTACA
GACCGAAACCACGGATCTTAGCTTGATGCTAGAACAGTTGACGTTCGAATTTTTACCGCTGCTAGAAGAAAAGAACCTTC
ATTGGCAACTGCAACTACAGAAAAAAGTCTATGCGACTGTCGATACAGAGAAGATGGAACGCGTCTTTGATAACTTGATT
CGCAATGCCATCAATTATAGTTATGCCGATTCCCCCTTGCATTTAGCCATCAGTACCTCTGATGATATCCTGATTCGTTT
GACCAATCATGGAAAAACGATCCCTGCTGAAAAGATTGGCTTGATTTTTGAGCCTTTTTACCGCATGGACGCTTCCCGAG
CAACGGCGACGGGTGGGACCGGTCTGGGGCTGCCGATCGCCAAAGAAATCGTTGAAGCATTAGGTGGAAAAATCTGGGCG
GAAAGCCGTGACGAAACCATCGTCTTTTCGATTCGCCTACCGAAGGTAGCAATGGAAAAAAATGAACAGCGGTCAAAGCC
CCATCCATCTGAACCAACCGCTTAA

>Gly|VanS-C_3_EU151752|Glycopeptides|VanC-type_regulator|VANSC
ATGCTCCTCTTGATTCTGATCCCTTTAACTGTTCGCTTTGTAGCAGGATTGAGGGTTTGGTACGGCTATGAACCCATTTA
TCAAATATTACGGCTTTTTGCTGATTATTGGCTCGTCTGTCTAGCCATCGGTGCCTTGCTGATCTGGGCAAGTACAACGA
TTTATTATATGAGTAAAGCCATCAGCTATTTGAATGAAACGATCCAAGCCACGAATCAATTGATTGCCGAACCCACGAAG
CGAATCATTCTCTCCAGCAATCTGAACGATGTGCAAGAAGAAATGAACCAGTTACGGGAAAAAAATCTCCAAGATCAACG
AGCAGCCAAAGAAGCAGAGCAGCGGAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGCACACCTTTGACCAGTG
TGATCGGCTACTTGACGCTGTTAGAAGAGGAACCTCAGCTTTCTACCGAACTACGGGCACGCTATACCAAGATCGCCTTG
CAAAAAGCCCAGCGGCTAGAATTATTGATCAGCGAGTTTTTCGAAATCACCCGTTTTAATCTTACAACGATCGCCTTACA
GACCGAAACCACGGATCTTAGCTTAATGCTGGAACAGTTGACGTTCGAATTTTTACCGCTGTTAGAAGAAAAGAACCTTC
ATTGGCAACTGCAGCTACAGAAAAAAGTCTTTGCGACCGTTGATACGGAGAAAATGGAACGCGTTTTTGATAACTTGATC
CGCAATGCCATCAACTATAGTTATACCGATTCCCCCTTGCATTTAGCCATCAGTGCCTCTGATGATATCTTGATTCGATT
GACCAATCATGGGAAAACGATCCCTGCTGAAAAAATTGGCTTGATTTTTGAGCCTTTTTATCGGATGGACGCTTCACGAG
CGACTGCGACTGGTGGAACCGGTCTGGGGCTGCCGATCGCCAGAGAAATCGTTGAAGCATTAGGTGGAAAAATCTGGGCG
GAAAGCCGTGACGAAACCATCGTCTTTTCGATTCGCCTACCAAAGGCAGCAATGGAAAAAAATGAACAGCGATCAAAGCC
CCATCCATCTGAACCAACCGCTTAA

>Gly|VanSc3|AY033764|1604-5662|1059|Glycopeptides|VanC-type_regulator|VANSC
ATCTTGATCATCATTCCTTTCGCAGTACGCTTCGTTGCTGGAATGAGGGTCTGGTATGGCTATGAACCCATTTATCAAAT
TTTACGTCTTTTTGCTGACTATTGGCTTCTTTGCTTAGCCATCGGGGCCTTACTGATTTGGGTGAGCACAACGATTTATT
ATATGAGTAAAGCTATCAGTTATTTGAATGAAACGATCCAAGCCACAAACCAACTGATTGCCGAACCCACGAAGCGAATC
GTTCTTTCCAGCAATATGATTGATGTGCAAGAAGAAATGAACCAGTTGCGAGAGAAAAACTTACAGGATCAACGAGCCGC
CAAAGAAGCGGAACAACGAAAAAATGATTTGATCGTCTATCTCGCACATGATTTACGAACGCCTTTGACCAGTGTGATCG
GCTATTTGACGCTTTTAGAAGAGGAACCACAGCTTTCTACCGAACTACGCGCACGCTATACGAAGATCGCCTTGCAAAAA
GCCCAACGGCTGGAACTATTGATCAGCGAATTTTTCGAAATCACCCGCTTTAATCTTACAACGATCGCCTTGCAAACTGA
AACCACGGATCTGAGCTTGATGCTGGAACAATTGACGTTTGAATTTTTGCCGCTGTTAGAAGAAAAAAACCTCCATTGGC
AACTTCAGCTACAGAAAAAAGTCTTTGCGACCGTTGATACGGAGAAAATGGAACGCGTTTTTGATAACTTGATCCGCAAT
GCCATCAATTATAGCTATCCTAACTCCCCTTTGCGATTAGCCATCAGCGAGTCTGATGATATCCTGATTCGTTTGACCAA
TCAAGGAAAAACGATCCCAGCTGAAAAGATCGGCTTGATTTTTGAGCCTTTCTACCGCATGGATGCTTCCCGAGCAACAG
CGACGGGTGGGACGGGTCTTGGTTTGCCGATCGCCAAAGAAATCGTTGAAGCATTAGGTGGAAAGATTTGGGCGGAAAGC
CGTGATGAAACCATCGTCTTTTCGATTCGCCTACCGAAGGCAGCAATGGAAAAAAATGAACAGCTGTCAAAGCCCCATCC
ATCTGAACCAACCGCTTAA

>872|DQ022190.1|DQ022190|Glycopeptides|VanC-type_regulator|VANSC
TTGAAAAATAGAAATCCTTTGATCCGAAAGCTCTTGACCCAATACTTCGTCACCACTGGAATCTTGCTGGCATTCCTTGT
AATGATTCCATTAGTCATTCGCTTTATTGCCGGAACCCGGACTTGGTATGGAACGGAACCTATCTACTATATCTTACGTT
TTTTTGCGGATCGCTGGTTGTTTTGTGTTGCGATAGGCGCTTTACTGATATGGTTTGGTACCACCATTTACTATATGACC
AAAGCCATCGGTTATTTGAATGAAACGATCCAAGCCACGACTCAACTGATAGAAGAACCAACCAAACGCATCACTTTGTC
GAGCCATCTGGTTGATGTTCAAGAGGAAATGAATCAACTGCGGGAGAAAAGTCTGCAAGATCAACGTGCCGCTAAAGAAG
CGGAACAGCGGAAAAATGATTTGATCGTTTATCTCGCCCATGATTTGCGGACGCCTCTGACAAGTGTCATAGGTTATCTG
ACTCTTCTAAAAGAAGAACCACAATTATCCAATGCGATGCGGAATCGTTACACGGAGATTGCTTTACAAAAAGCCCAACG
GCTGGAACTATTGATCAGTGAATTCTTCGAGATCACACGCTTCAATTTGACCACGATCGTTTTGCAGACAGAAACGACTG
ATTTAAGTTTAATGCTTGAACAGCTGACCTTTGAGTTTTTACCTCTCTTGGAAGAAAAGAATCTAAATTGGCAACTCAAC
TTACAAAAAAATGTTCTTGCAACAGTAGACACCGAAAAAATAGCTCGTGTCTTTGATAATCTCATTCGCAATGCCATCAA
CTACAGCTATCCAGATTCGCCTTTACTTCTTGAATTGGTCGAATCAGACAGTATCCACATTCGTCTGACGAATCGTGGAA
AAACAATTCCAGAAGAGATGATCGGACGTCTCTTTGAACCTTTCTATCGCATGGATTCTTCCCGAGCTACAGCCACAGGC
GGAACTGGTCTTGGTCTTCCGATTGCAAAAGAGATTCTGTTAGCATCTGGCGGGGATATCTCGGCAGAAAGCAAAGACGA
AACCATCATTTTCAACGTTCGCTTGCCAAAACCTGCCAACAGCTGA