MEGAResFrom MEG, the Microbial Ecology Group

VANRC

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanC operon and is a regulator gene.

References

Other Groups in VanC-type regulator

Sequences

Download Sequences

>Gly|VanRc3|AY033764|3846-4541|696|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATTGTTGTTGATGATGAAAAAGAAATCGCGGAGTTAGTCACGACGTTTCTAAGGAATGAAGGCTT
CCAAGTAGAACCTTTTTATGATGGAACGAGCGCTTTGGCTTATCTTGAAAAAGAAACGGTCGACGTGGCGGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGCTGCAGCAAATTCGTAAGACCCACTTTTTCCCAGTACTGATGCTCACG
GCAAAAGGGGAAGACTTGGATAAAATCACCGGTCTAAGCCTTGGGGCAGATGATTATGTGACCAAGCCCTTCAATCCTTT
AGAAGTCGTTGCTCGGGTCAAAACGCAGCTGCGGCGATACCAGCGTTACAACCAGTCAGCGAATCCCCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGCCACCAATGTTTTCTTTATGGCAAAGAGGTTTTCTTGACCCCC
ATCGAATTTAAAATCTTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACCCTTTTTGAAGCAGTTTG
GAAAGAAAAGTATCTAGACAACAATAACACAGTGATGGCACATATCGCCCGTTTGCGGGAAAAACTGAATGAACAACCCC
GCAAACCGAAATTAATCAAAACCGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>Gly|VanR-C_3_EU151752|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATCGTTGTTGATGATGAAAAAGAAATCGCCGAGTTAGTCACGACGTTTCTAAGAAATGAAGGTTT
CCAAGTGGAACCTTTTTATGATGGAACGAGTGCTTTGGCTTATCTCGAAAAAGAAACAGTCGATGTGGCAGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGTTACAGAACATTCGCAAAACCCACTTTTTTCCAGTACTGATGCTCACT
GCTAAAGGAGAAGATCTGGATAAAATTACCGGTCTAAGTCTAGGTGCAGATGATTATGTGACCAAACCTTTCAATCCATT
AGAAGTTGTTGCTCGGGTCAAAACGCAACTACGGCGATACCAACGATACAATCAGTCAGCTGTTCCGCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGCCACCAATGTTTTCTTTATGGCAAAGAGGTTTTTTTGACCCCA
ATCGAATTTAAAATCTTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACCCTTTTTGAAGCAGTCTG
GAAAGAAAAATATTTAGACAACAATAACACAGTGATGGCACATATTGCCCGTCTGCGGGAAAAGCTAAACGAACAACCAC
GCAAACCGAAATTAATCAAAACTGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>Gly|VanRc4|EU151753|3848-4543|696|Glycopeptides|VanC-type_regulator|VANRC
ATGGCAGAAAAAATAATTGTTGTTGATGATGAAAAAGAAATCGCCGAGTTAGTCACGACGTTTCTAAGGAATGAAGGCTT
TCAAGTGGAACCTTTTTATGATGGAACGAGTGCTTTGGCTTATCTCGAAAAAGAAACAGTCGATGTGGCAGTTTTAGATG
TGATGCTGCCGGATATCGACGGCTTTCAGCTGTTACAGACCATTCGCAAAACCCACTTTTTTCCAGTACTGATGCTCACT
GCCAAAGGAGAAGATCTGGATAAAATTACCGGTCTAAGTCTAGGTGCAGATGATTATGTGACTAAGCCCTTCAATCCATT
AGAAGTTGTTGCTCGGGTCAAAACGCAACTACGGCGATACCAACGATACAATCAGTCAGCTGTTCCGCAGAAGATTGAAG
AATACGAAAAGGAAGGCTTACTGTTGAAAATCAACAGTCACCAATGTTTTCTTTATGGCAAAGAGGTTTTCTTGACCCCC
ATCGAATTTAAAATCCTGCTTTACTTATTTGAACACCAAGGATCGGTCGTTGCCTCGGAAACTCTTTTTGAAGCAGTCTG
GAAAGAAAAATATTTAGATAACAATAACACAGTGATGGCACATATTGCCCGTCTGCGGGAAAAGCTAAACGAACAACCCC
GCAAACCGAAATTAATCAAAACTGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>871|DQ022190.1|DQ022190|Glycopeptides|VanC-type_regulator|VANRC
ATGTCAGAAAAAATAGTCGTTGTTGATGATGAAAAAGAAATTGCGGACTTAGTCACGACCTTTTTGCAAAACGAAGGATT
TAGTGTGCAGCCGTTTTATGATGGTACTAGTGCCATCGCCTATATTGAAAAAGAAGCCATTGATTTGGCCGTTTTAGATG
TCATGTTGCCGGACATTGATGGTTTTCAACTGTTACAGCAGATCCGCAAGACCCATTTTTTCCCAGTGTTGATGCTGACT
GCCAAGGGAGAGGATCTAGACAAAATCACTGGATTGAGTTTGGGAGCGGATGACTATGTCACCAAACCTTTTAATCCTTT
AGAAGTTGTGGCTCGGGTAAAAACCCAATTGCGGCGCTACCAGCGATACAATCATTCCACTGCTTCTCCAACAGTAGAAG
AATATGAAAAAGACGGCTTGATACTCAAAATCAACAGTCATCAATGCATTCTCTACGGCAAAGAAGTTTTCCTGACTCCC
ATTGAGTTCAAAATATTGCTTTATTTATTTGAGCACCAAGGATCCGTCGTCTCTTCCGAAACACTTTTCGAAGCGGTTTG
GAAAGAAAAATATTTAGATAACAATAATACTGTCATGGCACACATTGCTCGTTTAAGAGAAAAATTGCATGAAGAACCTC
GTAAACCTAAATTAATCAAAACCGTATGGGGGGTCGGCTATATCATTGAAAAATAG

>314|AF155139.2|AF155139|Glycopeptides|VanC-type_regulator|VANRC
ATGAAAAATATAACAATATTAATAGCTGATGATGATGCTGAAATTGCTGATTTGGTTGCTATACATTTAGAGAAAGAAGG
GTATCGTGTCATTAAGGTATCGGATGGGCAAGAAACCATTGATGTTATCCAGAACCAACCCATTGATTTACTGATTTTGG
ATATTATGATGCCGAAAATGGATGGATTTGAAGTGACACGTCGCATTCGCGAAAAACATAATATGCCCATTATTTTTTTG
AGCGCTAAAACGTCTGATTTTGATAAAGTGCAGGGACTCGTGATTGGAGCAGACGATTATATGACGAAACCATTTATACC
CATTGAATTGGTAGCTCGGGTAAATGCACAGCTGCGACGCTTTATGAAGTTGAATCAACCTAAAACCAAACAGAACTCAA
ACTTGGAATTTGGAGGATTAACGATTTCTCCTGAACAACGTACAGTTACTCTATATGGTAAGAATATTGAGTTAACACCG
AAAGAGTTTGAAATTTTATTTTTATTAGCCAGTAATCCAAATAAAGTTTATCGTGCAGAAGATATTTTTCAGAAGGTATG
GGGGGATGCATACTATGAAGGTGGGAATACCGTTATGGTTCATATTCGTACTTTGCGGAAAAAACTTGAAGAGGATAAAC
GAAAAAACAAATTGATACAAACTGTATGGGGGGTAGGTTATAAATTCAATGGGTAA